470 likes | 730 Views
Synthetic Biology. Lecture 1: Introduction to Synthetic Biology. What is Synthetic Biology?. Genetic Manipulation? Genetic selection carried out for millenia (domestication of animals) Mendelian selection ‘rationalized’ process. Recombinant DNA .
E N D
Synthetic Biology Lecture 1: Introduction to Synthetic Biology
What is Synthetic Biology? • Genetic Manipulation? • Genetic selection carried out for millenia (domestication of animals) • Mendelian selection ‘rationalized’ process. • Recombinant DNA
Engineering Goal: To build components that can be reliably and predictably assembled into ever more complicated systems
Fumbling Around • Current Systems are “Art”
Composability • OK - suppose we have individual parts that work, can we actually put them together such that they work in a well-defined/predictable way?
Standardization • Assembly • Part “Definition” • Interactions • Load • Input/Output • Stability
Standardizing a “Part” • BioBrick - standard ends, restrictions on internal sequence
What constitutes a part? • The DNA Sequence? • The function?
DNA Sequence • TAATACGACTCACTATAGGGAGA (T7 promoter)
Load: Imposing on our Hosts • Parts don’t exist in a vacuum. • Cells may dislike the parts, resulting in mutation or rejection • Too much modification may result in cells that just give up and die
Our Parts aren’t necessarily Stable • Anything that adds load to a cell reduces its fitness vs. cells that ‘lose’ the part • Mutations: Losing a plasmid, alteration of promoters to not work as efficiently (or not at all) • Antibiotic resistance, dependence
Application Goals • Bacterial robotics • Microbial factories • Adding features to plants to reduce environmental requirements/impact
Public Policy http://www.repeatfanzine.co.uk/Images/Impage/no%20gmo.jpg
Is the fear so Irrational? • We claim we can make all sorts of cool things, why not something ‘evil’?
What is different now? • Rapid Sequencing • Lots of sequence data on the internet • Protocols available online • Fedex Synthesis • Data on Pathogens?
The good news Major weaponized biological agents have existed for decades Virulence, resistance, transmissibility were all enhanced prior to SB. The major advantage of our approach is putting together well characterized components. Creating new pathogens would require a full scale research effort
Summary • Engineering instead of Science • Modularity and Abstraction are powerful techniques • Mechanical Engineering, Electrical Engineering were all at the stage where it was “too complicated”.