1 / 27

Molecular Testing and Clinical Diagnosis

Molecular Testing and Clinical Diagnosis. Amplified nucleic acid testing Part III. Objectives: At the end of this lesson the student will:. Describe and evaluate types of target sequences (DNA, mRNA, tRNA, rRNA) (C3) Describe and compare amplification processes including (C3)

uriel-witt
Download Presentation

Molecular Testing and Clinical Diagnosis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Molecular Testing and Clinical Diagnosis Amplified nucleic acid testing Part III

  2. Objectives: At the end of this lesson the student will: • Describe and evaluate types of target sequences (DNA, mRNA, tRNA, rRNA) (C3) • Describe and compare amplification processes including (C3) • Basic steps of an amplification process • Principles of methods available PCR, LCR, SDA, NASBA, TMA • List and describe the function PCR components in the reaction mix (C2) • Describe the variations of PCR process (C2) • LCR • Reverse Transcription-PCR • Real time PCR

  3. Objectives: At the end of this lesson the student will: • Explain the application of PCR to STR testing (C2) • Paternity testing • Forensic testing • RFLP mapping • Describe the significance of the following PCR considerations (C2, A2) • Contamination • Quality control • Lab space allocation

  4. Strand Displacement Amplification- BDPobeTec ET system • One hour assay • fluorescence detection • automated and semi-automated systems • pre-dispensed reagent devices

  5. Strand Displacement Process • step 1: primer hybridization • step 2: primer extensions by DNA polymerase leads to strand displacement • step 3: extended probe binds complimentary strand • step 4: probe is extended creating BsoBI site • step 5: BsoBI cleaves dsDNA

  6. Detection linked with amplification. Target must be amplified and double stranded to enable the restriction enzyme to function. Fluorescence only occurs when there is cleavage.

  7. SDA lends itself to automation since it is isothermal.

  8. Transcription-Mediated Amplification • RNA transcription amplification system using two enzymes: RNA polymerase and reverse transcriptase • Isothermal amplification of nucleic acid target producing RNA product amplification • Rapid kinetics results in excess of ten billion-fold amplification within 15-30 minutes • Combined with Hybridization Protection Assay detection in a single tube format

  9. Transcription-Mediated Amplification Components • Primers: Oligonucleotides that hybridize to target and initiate the reaction • Nucleotides • Enzymes drive the reaction: • T7 RNA polymerase • transcribes RNA from DNA • Reverse transcriptase (MLV): • synthesizes DNA from RNA or DNA • RNAse H activity: degrades RNA after it has been copied into DNA

  10. Transcription-Mediated Amplification

  11. TMA: Gen-Probe Second GenerationAPTIMATM Assays • Target Capture sample processing partially purifies target nucleic acid • Transcription-Mediated Amplification-- amplified target • Dual Kinetic Assay (DKA) technology simultaneously detects two organisms

  12. Gen-Probe Proprietary Target Capture Technology N Bead ––TTTTTTTTTTTTTT Oligo ––TTTTTTTTTTTTTT Capture Oligo "Tail" one micron Magnet AAAAAAAAAAAAAAAAAA magnetic •••••••••••••••••••••••••• ––TTTTTTTTTTTTTT particle ––TTTTTTTTTTTTTT .....GAUCGAUCCCCCCUAGCGGUGCAUCUAGCAUCUA.... ––TTTTTTTTTTTTTT GGATCGCCACGTAGATCGGCCTC ––TTTTTTTTTTTTTT ••••••••••••••••••••••••••••••••••••• ––TTTTTTTTTTTTTT S Capture Sequence These are washed away: Cell debris Protein Target non-specific Sequence Plasma DNA/RNA

  13. Detection by Dual Kinetic Assay (DKA) Technology • Hybridization Protection Assay (HPA) Technology • Two modified acridinium ester labels with different light-off kinetics on different DNA probes • “Flasher” fast • “Glower” slow • Simultaneous detection of different organisms

  14. Dual Kinetic Assay (DKA) 120,000 CT + GC CT 100,000 GC 80,000 RLU 60,000 40,000 20,000 0 .52 .68 .84 1.00 1.16 1.32 1.48 1.64 1.80 1.96 .04 .20 .36 Time in Seconds

  15. TMA Amplicon Production TMA Amplicon Production Starting with 1000 copies of Target 1E14 1E12 1E10 1E8 Amplicon copies 1E6 1E4 1E2 1E0 0 5 10 15 20 25 30 35 40 45 50 55 60 Time (min.)

  16. Gen-Probe Instrumentation Systems • Fully automated, APTIMATM amplification assays for TIGRISTM • Target Capture system • VIDAS* dual platform: Amplified assays and immunoassays *from bioMérieux

  17. Challenges with Current Nucleic Acid Amplification Tests • Carry-over contamination can cause false positives • Verification of positive results is difficult • Inhibition can cause false negatives • Compared with current microbiology tests: • Increased labor • Higher cost • Low throughput

  18. Methods for Control of Carryover Contamination in automated TMA Assays • Unidirectional workflow • Single-tube format • Oil as a barrier to the environment • HPA format eliminates wash steps and potential aerosols • Treatment of RNA amplicon with detection reagents • Bleach destroys nucleic acids

  19. Comparison of TMA with PCR and LCR Amplification Methods TMA ( Gen-Probe ) PCR ( Roche ) LCR ( Abbott ) Ligase DNA polymerase RNA polymerase Reverse transcription Enzymes DNA polymerase Thermal Isothermal reaction Thermal cycling Thermal cycling Conditions Amplified RNA DNA DNA Product Homogeneous Wash step assay no wash Wash step required Wash step required steps Detection System Chemiluminescence Absorbance Fluorescence Special Thermal cycler, equipment microtiter plate Thermal cycler, Luminometer needed reader/washer LCx instrument

  20. Gen-Probe HIV-1/HCV dual-assay protocol for blood supply Step One SampleProcessing Extract RNA ~ 90 minutes (Hybridized target captured on to microparticles) Step Two TMAAdd Amplification Reagent, Oil Reagent 10 minutes 41.5°C Add Reverse Transcriptase, RNA Polymerase 60 minutes 41.5°C Step Three HPAAdd Probe Reagent(Hybridizes to amplicon) 15 minutes 60°C Add Selection Reagent 10 minutes 60°C Read in Luminometer

  21. Pooling Scheme 16 16 16 16 128 Pool 16 16 128 Donations 16 16

  22. 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Resolution Testing 16 16 16 16 128 16 16 1 1 Reactive Pool Test Primary Pools Identification of Single Donation 16 16

  23. HCV Panel 6211 – Virologic/Serologic Profile 46 Days S/CO HCV PCR Quantitation Days PCR E991685 7-14-99 25

  24. Summary: Amplification Methods • Much like a culture technique, they increase likelihood of detection and identification • Enzymes are used to increase target sequence for detection • May be automated or semi-automated more easily if isothermal

  25. Summary Amplification Methods • Increased sensitivity • amplification • detection systems • Specificity • primers • probe/detection systems

More Related