I nformatics goes system biology

1. Informatics goes system biology Christophe Roos - MediCel ltd christophe.roos@medicel.fi Molecular biology goes in silico Bioinformatics Part 1: a teaser Gene-networks in signaling Drosophila as a model Christophe Roos - Bioinfo primer

2. From single cell to organism – a life cycle The use of a model organism • Fertilisation followed by cell division • Pattern formation – instructions for • Body plan (Axes: A-P, D-V) • Germ layers (ecto-, meso-, endoderm) • Cell movement - form – gastrulation • Cell differentiation • Cell growth, cell death (apoptosis) Christophe Roos - Bioinfo primer

3. Development of the body plan • We are much more like flies in our development than you might think. • Drosophila is the best understood of all developmental systems. • We have evolved by two genome duplications • Like all animals with bilateral symmetry, the fly embryo is patterned along two distinct and largely independent axes: Anterior-Posterior and Dorsal-Ventral Christophe Roos - Bioinfo primer

4. Pattern formation – germ layers Christophe Roos - Bioinfo primer

5. 5 text slides Bioinfo From lab bench to computer keyboard • Molecular biology is the mother of Biotechnology, an area with huge potential applications. • Molecular biology has handled on single genes and proteins, but now methods make it possible to operate on large sets simultaneously. • Information technologyis an essential enabling technolgy(tool) in molecular biology. We know it as bioinformatics or biocomputing. • Bioinformatics is to a large extent a predictive science, the results of which enter public and private electronic databases. Christophe Roos - Bioinfo primer

6. 4 text slides Bioinfo The experimental data hits the hard disk • Biological data is accumulating at a high rate • DNA and protein sequence • Gene expression profiles • Protein structure • Scientific litterature are accumulating at a high rate. • The genome of several organisms has been sequenced (many viruses and bacteria, yeast,C.elegans and the fruitfly Drosophila). Most of the DNA sequence of the complete human genome has been determined. Christophe Roos - Bioinfo primer

7. 3 text slides Bioinfo … but what is the data? genome, gene, protein • Each cell contains a full genome (some exceptions), it consists of DNA • The size varies: • Small for viruses and prokaryotes (10 kbp-20Mbp) • Medium for lower eukaryotes • Yeast, unicellular eukaryote 13 Mbp • Worm (Caenorhabditis elegans) 100 Mbp • Fly, invertebrate (Drosophila melanogaster) 170 Mbp • Larger for higher eukaryotes • Mouse and man 3.000 Mbp • Very variable for plants (many are polyploid) • Mouse ear cress (Arabidopsis thaliana) 120 Mbp • Lilies 60.000 Mbp Christophe Roos - Bioinfo primer

8. 2 text slides Bioinfo … the data genome, gene, protein • The genome is partitioned over one or many chromosomes. Their number is constant within a species but varies between species (range ca. 1-100). • The chromosome is one DNA double helix molecule • A gene is the smallest functional unit on a chromosome that codes for a protein or an effector RNA (e.g. tRNA and rRNA). The gene is directional (5’ end → 3’ end). • Regulatory regions (promotor & enhancer) • Transcribed regions: exons and introns • Introns are spliced away during maturation, exons are concatenated • Exons make up the 5’ UTR, the CDS and the 3’ UTR) chromosome promotor mRNA 5’UTR CDS 3’UTR Christophe Roos - Bioinfo primer

9. Last insert Bioinfo … the data genome, gene,protein • The proteins are formed by amino acids, each of them (20 different) is coded for by one or several triplets (43=64 different). • As the gene code is read is triplets, it is essential to keep the frame correct (theoretically 3 forward and 3 reverse frames for any DNA segment). • The polypeptide chain is linear but folds into a 3D-structure. • The 3D structure is pivotal for the function of most proteins • The 3D structure consists of folds • Some discrete structures make up the folds (a-helix, b-sheet, etc.) • The 3D structure cannot (yet) be predicted, but can be measured by NMR or X-ray spectroscopy of crystals. • The structure is not static and depends also on partners. Christophe Roos - Bioinfo primer

10. Genes control cell behavior by controlling which proteins are made by a cell • Genomic content constant: all cells have the same instructive set • Differential gene activity controls development • Understanding development means a.o. understanding gene control • Chromatin structure • Transcription • Processing (splicing) • Nuclear export • Cytoplasmic location (storage) • Translation • Modifications of the polypeptide • Glycosylation (sugars) • Proteolytic cleavage • Complex formation Christophe Roos - Bioinfo primer

11. Development is progressive • Specification of cell fate: determination • All cells still ‘look the same’ • Can be tested by transplantation experiments • Interactions can make cells different from each other: induction Christophe Roos - Bioinfo primer

12. Patterning – interpretation of positional information • Positional value • Morphogen – a substance • Threshold concentration • Program for development • Generative rather than descriptive Christophe Roos - Bioinfo primer

13. The bicoid gene provides an A-P morphogen gradient Christophe Roos - Bioinfo primer

14. The A-P axis is divided into broad regions by gap gene expression • The first zygotic genes • Respond to maternally-derived instructions • Short-lived proteins, gives bell-shaped distribution from source Christophe Roos - Bioinfo primer

15. Transcription factors in cascade • Hunchback (hb) , a gap gene, responds to the dose of bicoid protein • A concentration above threshold of bicoid activates the expression of hb • The more bicoid transcripts, the further backhb expression goes Christophe Roos - Bioinfo primer

16. Krüppel reads two values • Krüppel (Kr), a gap gene, responds to the dose of hb protein • A concentration above minimum threshold of hb activates the expression of Kr • A concentration above maximum threshold of hb inactivates the expression of Kr Christophe Roos - Bioinfo primer

17. Segmentation: activation of the pair-rule genes • Parasegments are delimited by expression of pair-rule genes in a periodic pattern • Each is expressed in a series of 7 transverse stripes Christophe Roos - Bioinfo primer

18. Universals: The homeotic genes also specify human development • Lewis Wolpert, Rosa Beddington, Jeremy Brockes, Thomas Jessel, Peter Lawrence, Elliot Meyerowitz, Principles of Development, Current Biology ltd, Oxford University Press 1998, ISBN 0-19-850263-X Christophe Roos - Bioinfo primer

19. Genes are controlled by activating and repressing transcription factors that bind the promotor promotor • The 500bp promoter region of the even-skipped gene • Gene expression occurs when the activating factors are present above a threshold • Repressors may act by preventing binding of activators Christophe Roos - Bioinfo primer

20. … understand the promotor What we might know about the promotor: ...CAGTGCTAATATAAAACTGATATTTAATTGAAATCTTTTCTAATTTAGCGCGCTCAGCTGTTGGGTGACCTTGCTGCCGTTCAAATTCCGGAGGAGGAGCTGCAGCAGTATACTTCCATTAGCCAAGTGCAAACCGTGGGATTAAAGCGTCTACCCACCCTTGACGAGTATCTAGCCAAGAAAAAGGAAAGACAGGCCCAAGTTTTAGCTGAAAAAAGCTCGGCGTCGGGTCTCCGCGTAAATGCTATAAAGGGCTCCAAGCGCAAGCTTCTCGTCGAAGAGGAGGAGGAACTACAGGCCAAGCGAAAGAATCCGAATGTAATTAGCGTGGAGGAAGATGACGAAGATTCTTCATCCTCTGATGAGGACGATGAGGAGGCACCAGCTCAATCCGCTCCTATTGCCATACCCACTCCAGTGTCTATAGCTCCACCGCAAATCGCTGTTAAACCACCCATTAAAAAGTTGAAGCCAGAGCCTAACCCACCTGCCTGTATCCACCAGACTGTCTATGTGCCCGTACATCGGACAACAGAAGTTCAGAATGCCCGTCTTCGACTGCCTATCCTCGCGGAGGAGCAGCAGGTGATGGAGACAATCAACGAAAACCCCATTGTGATCGTGGCTGGTGAGACTGGCTCTGGAAAGACTACCCAGCTACCGCAGTTCCTGTACGAAGCGGGGTATGCCCAGCACAAGATGATTGGAGTGACGGAGCCGCGGCGAGTGGCTGCTATTGCCATGTCCAAGCGGGTGGCCCACGAGATGAACCTGCCGGAGAGCGAGGTGTCATACCTCATTCGCTTCGAGGGAAACGTAACACCAGCGACGCGCATTAAATTCATGACAGATGGTGTGTTGCTTAAGGAGATCGAAACTGACTTTCTGCTTAGTAAGTACTCAGTGATCATCCTGGACGAGGCGCACGAGCGCAGTGTTTACACAGACATCCTAGTGGGTCTCCTGTCAAGGATCGTGCCCTTGCGTCACAAACGCGGGCAGCCGCTGAAGCTGATCATTATGTCTGCCACTTTGCGGGTATCCGATTTTACAGAGAATACTCGCTTGTTTAAGATTCCGCCACCGTTGCTTAAAGTGGAGGCTCGACAATTTCCGGTGACTATTCACTTCCAGAAGCGCACACCTGATGACTATGTGGCGGAGGCTTACCGCAAGACCTTAAAAATCCATAATAAGCTTCCGGAAGGCGGCATACTAATTTTTGTGACGGGACAGCAGGAGGTCAACCAACTGGTGCGCAAGCTGCGACGTACGTTTCCGTATCATCATGCGCCAACCAAGGATGTCGCTAAAAATGGAAAGGTATCGGAGGAAGAAAAAGAGGAAACAATAGATGATGCGGCATCGACTGTGGAGGATCCCAAGGAGCTGGAGTTTGATATGAAACGAGTTATACGTAATATTCGTAAATCTAAGAAAAAGTTCTTGGCGCAAATGGCGTTACCCAAAATCAATTTGGACGACTACAAGCTCCCTGGTGATGATACGGAAGCAGACATGCACGAGCAGCCGGATGAGGATGATGAGCAGGAGGGACTAGAAGAGGATAACGACGATGAACTAGGCTTGGAGGATGAGTCGGGAATGGGATCTGGTCAAAGGCAACCTCTGTGGGTCCTGCCGCTCTACTCGCTCCTCTCCTCGGAGAAGCAAAACCGCATCTTCCTGCCCGTTCCCGATGGCTGCCGGCTATGCGTGGTTAGCACCAATGTGGCAGAGACATCTCTCACCATCCCGCACATCAAGTATGTTGTTGACTGTGGTCGCCAGAAGACGCGTCTTTACGACAAACTGACGGGTGTGAGTGCTTTTGTGGTAACCTACACGTCTAAGGCCTCGGCGGATCAGCGTGCTGGACGAGCGGGTCGCATCAGCGCCGGACATTGCTATCGCCTCTACTCGAGTGCCGTGTACAACGACTGCTTCGAGGACTTTTCCCAGCCGGATATCCAGAAAAAGCCCGTCGAGGACCTTATGCTGCAAATGCGCTGCATGGGCATCGATCGCGTGGTGCACTTTCCCTTTCCCTCACCACCGGATCAAGTGCAGCTGCAAGCCGCCGAGCGGCGATTGATCGTGCTAGGTGCCCTGGAGGTCGCCAAGACAGAGAATACAGATTTGCCACCAGCCGTTACTCGTTTGGGTCACGTTATCTCCCGCTTTCCCGTGGCGCCGCGCTTTGGAAAAATGCTGGCTCTGTCCCACCAGCAGAACCTACTGCCCTACACCGTCTGCCTGGTGGCCGCACTTTCAGTCCAGGAGGTGCTAATCGAAACGGGCGTTCAAAGGGATGAGGATGTGGCACCTGGCGCGAATCGGTTCCACCGCAAACGCCAAAGTTGGGCGGCCAGCGGCAACTATCAGTTGCTTGGAGATCCTATGGTCTTATTACGTGCCGTAGGAGCTGCAGAGTACGCCGGATCGCAGGGCCGCTTGCCAGAGTTTTGTGCTGCGAATGGATTGCGCCAGAAAGCGATGAGCGAGGTGCGAAAATTGCGCGTCCAGCTGACTAACGAGATTAACCTGAATGTTAGTGACGTTGAGCTGGGTGTGGACCCCGAACTGAAGCCTCCCACCGATGCCCAGGCGCGTTTCCTTCGCCAAATTCTATTGGCCGGCATGGGCGACCGGGTGGCTAGAAAGGTACCTCTGGCAGACATCGCCGACAAGGAAGAGCGGCGGCGATTAAAGTACGCATACAATTGTGCTGACATGGAGGAACCAGCGTTCCTGCACGTCTCATCCGTGTTGCGTCAAAAAGCACCCGAATGGGTAATCTATCAGGAGGCATACGAGCTGCAAAACGGCGACTCTACCAAGATGTTCATCCGCGGC... This page shows 3000 characters Thus, the human genome has about 106 pages … however Christophe Roos - Bioinfo primer

21. … the reality is certainly different What the protein regulators might know about the promotor: Christophe Roos - Bioinfo primer

22. … and when regulation concerns many genes simultaneously… Lytic cycle decision l-phage: 11 genes Human Genome: ~ 31 000 – 40 000 genes There is more than promotors McAdams and Shapiro Science, 1995, 269, pp.650-656 Christophe Roos - Bioinfo primer

23. Data types will diversify • While the promotor is a challenge to bioinformatics, it is only one tiny facet of biological data • Other data types concern among other • Gene transcripts or proteins present • At various time points • In different tissues • In diseases • Interactions between components • Pathways • Metabolic • Regulatory How can it be organised? Christophe Roos - Bioinfo primer

24. Pathway database, interaction database, ... Christophe Roos - Bioinfo primer

25. A wealth of databases • Primary and derived databases • Each one accessible viaseparate tools • sometimes cross-indexed • with separate syntax • with different levels of confidence • with errors We have a problem Christophe Roos - Bioinfo primer

26. Biology in the computing age • What does informatics mean to biologists? • Representing the data to the user • Organising the data in databases • Disseminating the data over Internet • Manipulating and interlinking of the data • Analysing of the data • What challenges does biology offer computer scientists? • Cracking the genome code • Presenting data in an intelligible form • Biological data is complex and interlinked • Multiple entities interact to form pathways, networks • Model, simulate and understand how living things function Christophe Roos - Bioinfo primer

27. System biology needs more • Mathematics, systematics, semantics • Reverse engineering • Modelling • Data mining • However, it has to be done starting from biological premises Christophe Roos - Bioinfo primer