1 / 29

MAE 291 – Biological Nanotechnology Goals – entrée into nanoscale biology for engineers

MAE 291 – Biological Nanotechnology Goals – entrée into nanoscale biology for engineers and engineering point of view for life scientists learn enough about subject to be able to recognize where biology is relevant to engineering and vice versa

venice
Download Presentation

MAE 291 – Biological Nanotechnology Goals – entrée into nanoscale biology for engineers

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. MAE 291 – Biological Nanotechnology Goals – entrée into nanoscale biology for engineers and engineering point of view for life scientists learn enough about subject to be able to recognize where biology is relevant to engineering and vice versa learn enough to read current literature yourself learn to read research papers critically Philosophy – course should be intellectually challenging and fun; grading will take into account divergent backgrounds and effort

  2. Didactic plan lecture-discussion based on ~1-2 literature papers/week sources of info: Google, Wikipedia, Philip Nelson’s Biological Physics: Energy, Information, Life homework problems based on lit. paper each week: may do as a group, get any help you want, but present in your own words mid-term, final will resemble homework problems 1 oral or written presentation/critique of lit. paper: I’ll suggest good candidates each week, or pick yourself (but check with me) grading: 20% each class participation, homework, midterm, student presentation, final; or 25% each if you choose not to take final

  3. Contact – Prof. J. Silver, jesilver@gwu.edu Office hours: TBA Papers, lecture notes, homework, previous week’s homework answers, announcements will be on Blackboard (along with related papers that might make good candidates for student presentations)

  4. Theme of course – biological molecules have rich structure and functions as nanomachines engineering tools help make it possible to learn about their structure and how they work with increasing knowledge we can make new nanostructures/machines with the same components principles/processes of nanoscale biological materials can inform design of non-biological nanotech./engineering

  5. References for class 1 Philip Nelson Biological Physics Ch 2 section 2.2 The Molecular Parts List, pp.45-62. http://www.exploratorium.edu/origins/coldspring /ideas/printit.html – Watson/Crick paper 1954 http://www.neb.com/nebecomm/tech_reference Genetic code; amino acid structures; DNA base pairs; Products Wikipedia – DNA structure, mechanical properties, etc.

  6. Biological Macromolecules - DNA Base pairing – at edges – holds strands together Base stacking – above & below - compresses ds into helix Boiling separates strands N 3’ 5’ 5’ 3’ RNA – like DNA, except OH at 2’ position, and Uridine for Thymine

  7. http://www.google.com/images?q=DNA&hl=en&gbv=2&tbs=isch:1,simg:CAISEglYWPmrg53qoyHd2bQ6MaaJlA,sit:o&iact=hc&vpx=409&vpy=76&dur=1373&hovh=232&hovw=217&tx=73&ty=305&ei=theBTJiwK4aBlAf_zpWuDg&oei=theBTJiwK4aBlAf_zpWuDg&esq=1&page=1&tbnh=127&tbnw=118&ved=1t:722,r:12,s:0&biw=956&bih=572http://www.google.com/images?q=DNA&hl=en&gbv=2&tbs=isch:1,simg:CAISEglYWPmrg53qoyHd2bQ6MaaJlA,sit:o&iact=hc&vpx=409&vpy=76&dur=1373&hovh=232&hovw=217&tx=73&ty=305&ei=theBTJiwK4aBlAf_zpWuDg&oei=theBTJiwK4aBlAf_zpWuDg&esq=1&page=1&tbnh=127&tbnw=118&ved=1t:722,r:12,s:0&biw=956&bih=572 3 5 5 3 1 4 5 2 3 3 5 Cutting at P -> one 3’ and one 5’ end 5 3 3 5 5 3

  8. Watson-Crick base pairs G-C 3 hydrogen bonds A-T 2 hydrogen bonds other hydrogen bond base pairs are possible in special circum- stances (class 4) purinespyrimidines (2 rings) (1 ring)

  9. Implications of double helix structure Suggests a replication mechanism based on separating strands, assembling a new copy strand with complementary sequence by base pairing engineering application – pol. chain rxn. (pcr) Suggests a sequence-specific binding between strands with complementary sequence – many applications! Makes dsDNA stiffer than ssDNA, but how stiff? Over what length? (~50nm, class 5) Helix suggests rotational motion may be important – e.g. to unwind, to move along grooves in helix (class 6)

  10. DNA can assume other structures besides the “B-form” Watson-Crick described, when single-stranded or when dsDNA is subjected to unusual conditions (dehydration, non-physiologic salts, interaction with intercalating dyes, pulling/twisting forces) e.g. A B Z some alterna- tive forms will be considered in classes 4 - 6

  11. Enzymes that act on DNA or RNA DNA polymeraseN strands are “anti-parallel” extension adds to 3’-end pol requires primer to start synthesis primer template

  12. Can chemically synthesizeN (buy) short pieces of DNA (“oligo”nucleotides~1-100 bases) of any sequence (~ $1/base for mmol = 6x1017 molecules) So can “prime” synthesis at any chosen location on template -> idea for exponential synthesis of segment of DNA using 2 primers that hybridize to opposite strands with appropriate 5’->3’ orientations

  13. Polymerase chain reactionN (pcr) amplification of DNA w/ thermostable DNA polymerase (e.g. Taqpol) copy strand (B) forward primer Taqpol template strand (A) Melt DNA (94oC), cool (60oC) to anneal primers, extend (72oC) new strand A reverse primer

  14. Old and new templates are not destroyed by melting, so repeated cycles of melting and polymerization -> 1 -> 2 -> 4 -> 8 -> … -> 2n copies of DNA region lying between 2 primer-annealing sites on initial template Polymerase copies ~1000b/m => ~1 hour for 230 =1010-fold amp. of a kb piece of DNA http://www.youtube.com/watch?v=_YgXcJ4n-kQ http://www.dnalc.org/ddnalc/resources/animations.html

  15. Portion of sequence of lambda phage DNA reads 5’->3’, only one strand of dsDNA shown 1 gggcggcgacctcgcgggttttcgctatttatgaaaattttccggtttaaggcgtttccg 61 ttcttcttcgtcataacttaatgtttttatttaaaataccctctgaaaagaaaggaaacg 121 acaggtgctgaaagcgaggctttttggcctctgtcgtttcctttctctgtttttgtccgt 181 ggaatgaacaatggaagtcaacaaaaagcagctggctgacattttcggtgcgagtatccg 241 taccattcagaactggcaggaacagggaatgcccgttctgcgaggcggtggcaagggtaa 301 Could you write sequence of opposite strand? Could you specify sequence of two 20 base primers to amplify segment consisting of bases 11-290?

  16. More enzymes that work on DNA Reverse transcriptase – copies ss RNA into DNA DNA primer RNA template (can also use ssDNA as template) Reverse transcriptaseN

  17. Other enzymes that act on DNA – restriction enzymesN Cut DNA backbone at specific short sequence; may leave ss overhangs that can be used to direct assembly of DNA pieces with complementary overhangs EcoRI 5’--GAATTC-- 3’--CTTAAG-- NheI 5’--GCTAGC-- 3’--CGATCG-- AvrII 5’--CCTAGG-- 3’--GGATCC-- http://www.dnalc.org/resources/animations/restriction.html http://en.wikipedia.org/wiki/Restriction_enzyme

  18. Map of enzymes that cut once What would cutting with EcoRI produce? Cutting with EcoRI + PstI? Cutting with SpeI + SacI? http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/dna_sequences_maps.asp

  19. Other enzymes that act on DNA – Ligases reform phosphodiester bonds – join pieces of DNA reverse effects of restriction enzymes may be guided by annealing of complementary overhangs fragments A fragments B GATC--atc--- +GATC-gcc-- --tag---CTAG -cgg--TTAA note multiple possible ligation products: AA, A , AB, B, AAA…, A , gatcBBttaa,… Can you get BA, BBB? A A Bttaa gatcB

  20. Some ligated fragments can be recut: EcoRI (GAATTC) EcoRI product restores EcoRI site 5’--G AATTC-- 3’ 5’--GAATTC-- 3’--CTTAA G-- 5’ 3’--CTTAAG-- Others cannot: NheI(GCTAGC) AvrII(CCTAGG) product = NheI or AvrII 5’--G CTAGG--3’ 5’--GCTAGG-- 3’--CGATC C--5’ 3’--CGATCC-- \

  21. More enzymes that act on DNA Gyrases – unwind ds DNAs Topoisomerases – cut and religate DNA strands, allowing one DNA segment to pass through another, relieving torsional strain or untangling entwined dsDNA circles (class 7) http://en.wikipedia.org/wiki/Topoisomerase

  22. RNA polymeraseN – partially melts dsDNA template and makes ssRNA copy Some RNA pol’s can use ssDNA as template (RNA is same as DNA except for OH group instead of H at pos. 2 on sugar and base U instead of T; RNA can be ss or ds, can base-pair with “complementary” DNA or RNA)

  23. Protein = linear polymer of amino acids (aa) Chains from a few to ~ 1000 aa long Order of aa’s determine protein structure, interacting surfaces, properties, function; most enzymes are prot. aa order encoded in order of bases in RNA

  24. Ribosome (protein-RNA complex) “reads” ssRNA sequence and assembles corresponding protein Coding conundrum How can 4 bases encode 20aa? Pairs of bases could only encode 16 aa Code must involve at least triplets… but then 64 codons. Why so many? Another problem for triplet code: Which is correct reading frame? …ACGTGCCTGATT… …ACG-TGC-CTG-ATT… or ..A-CGT-GCC-TGA-TT… or .AC-GTG-CCT-GAT-T…?

  25. George Gamow (GW physics prof) proposed elegant solution Maybe Nature doesn’t use codons that allow reading frame ambiguity AAA-AAA -> AAA (-4) AAN-ANN -> ANA (-12) … -> miraculously, only 20 codons left (Photo: Gamow explaining a point of interest to members of the Junior Academy of Scientists (GW Lisner Auditorium, 1952))

  26. Unfortunately for Gamow, nature preferred degeneracy! Several codons encode particular single amino acids; Other mechanisms control choice of correct “reading frame” And 3 “stop” codons (UAA, UAG, UGA) direct the ribosome to release template RNA and nascent protein Genetic codeN

  27. Central Biological Dogma: DNA <--> RNA -> protein The enzymes involved act as nanoscale motors/ machines; we will see how engineering has been used to study them in exquisite, single- molecule detail; how engineering is going beyond biology to make new materials and assemble devices on nm scale using biological components and principles DNA pol, pcr (reverse) RNA pol ribosome

  28. Next week – DNA as nanoscale building material 2 basic ideas use sequence complementarity as “glue” to stick pieces of ssDNA together in precise way flexibility of ssDNA allows strands to “switch” double helix partners -> branched structures

  29. Reading for next week (heavier than usual but don’t have to read critically – just try to understand what they did): 1st half of Seeman review (through static structures; we’ll consider dynamic structures the following week) He et al, JACS – first look at fig 1 in SOM to understand how they made 2-d assemblies He et al, Science – shows follow-up 3-d polyhedra Yin et al, Science – man-made tubes from DNA

More Related