From Gene to Protein

1. From Gene to Protein

2. Target • I can label a diagram of a DNA molecule including structural elements and bonds between strands.

3. Target • I can describe the primary function of DNA.

4. Human Genome • 3.2 million DNA base pairs • 1.5% encode proteins • 98.5% not protein encoding • ~ 31,000 genes encoding 100,000 - 200,000 proteins • How are 100,000 to 200,000 proteins produced from 31,000 genes? • What is the 98.5% of the human genome that does not encode proteins?

5. Proteins are worker molecules that are necessary for virtually every activity in your body

6. Targets • I can differentiate between transcription and translation. • I can locate within the cell and describe the steps of protein synthesis.

8. The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait DNA gets all the glory, but proteins do all the work! replication

9. Transcription fromDNA nucleic acid languagetoRNA nucleic acid language Animation!

10. RNA • ribose sugar • N-bases • uracil instead of thymine • U : A • C : G • single stranded • lots of RNAs • mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

11. Transcription • Making mRNA • transcribed DNA strand = template strand • synthesis of complementary RNA strand • transcription bubble • enzyme • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

12. RNA polymerase Matching bases of DNA & RNA A • Match RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U A 5' 3' G C C A T G G T A C A G C T A G T C A T C G T A C C G T

13. Transcription: the process • 1.Initiation~ proteins help RNA polymerase bind to the right spot of the DNA • 2.Elongation~ RNA polymerase continues unwinding DNA and adding nucleotides • 3.Termination~ RNA polymerase reaches terminator sequence

14. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have junk! • Eukaryotic genes are not continuous • exons = the real gene • expressed / coding DNA • introns = the junk • inbetween sequence intronscome out! eukaryotic DNA

15. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing Video • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • primary transcript = pre-mRNA • mRNA splicing • edit out introns • make mature mRNA transcript ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

17. Translation fromnucleic acid languagetoamino acid language

18. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

19. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets

20. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

21. UAC GCA CAU Met Arg Val How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon anti-codon tRNA aminoacid

22. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on opposite end

23. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small

24. Translation • Initiation • brings together mRNA, ribosome subunits, first tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon

25. A small ribosomal subunit attaches to a mRNA molecule. At the same time an initiator tRNA molecule binds to AUG on the same mRNA molecule. A large ribosomal subunit then joins the newly formed complex (not shown). 

26. Small ribosomal subunit As the ribosome moves along the mRNA molecule, the first tRNA is released leaving behind its amino acid. Another tRNA that recognizes the new mRNA codon takes the open position. Large ribosomal subunit

27. As the ribosome moves along the mRNA molecule, the first tRNA is released leaving behind its amino acid. Another tRNA that recognizes the new mRNA codon takes the open position.

28. This pattern continues as molecules of tRNA are released from the complex, new tRNA molecules attach, and the amino acid chain grows.

29. This pattern continues as molecules of tRNA are released from the complex, new tRNA molecules attach, and the amino acid chain grows.

30. This pattern continues as molecules of tRNA are released from the complex, new tRNA molecules attach, and the amino acid chain grows.

31. The ribosome will translate the mRNA molecule until it reaches a termination codon on the mRNA. 

32. The ribosome will translate the mRNA molecule until it reaches a termination codon on the mRNA. 

33. The ribosome will translate the mRNA molecule until it reaches a termination codon on the mRNA.  Animation!