Genes, Genomes and Genetic Analysis

1. Genes, Genomes and Genetic Analysis Genetics Spring 2014

2. Outline

3. Basic Terminology • Geneticsis the study of biologically inherited traits, including traits that are influenced in part by the environment. • Genes are the fundamental, physical and functional units of heredity that are transmitted from parents to offspring in reproduction. • Genes are the basic unit of biological information made of specific segments of DNA on chromosome (nucleus and mitochondria and ????) that encodes a particular protein or structural RNA molecule (coding locus). • Genome is the entire collection of genes in chromosomes in each cell; in eukaryotes commonly refers to all genes present in one complete haploid set. • Proteome is the entire collection of proteins encoded by an organism: may differ in particular cells, tissues, at different times of development, or in response to environmental factors.

4. Basic Terminology Biological information is encoded in DNA but gene expression requires transcription and translation. Biological function emerges primarily from protein molecules: polymers of amino acids that fold in 3-D. All living forms are closely related forming a molecular unity of life through the three Domains: Bacteria, Archaea, Eukarya. Genetic techniques permit dissection of biological complexity such as the construction of mutants with inactive, modified or over-expressed genes and assess phenotypes. The focus is on human genetics, with comparisons with and experimental results from model organisms.

5. The Human genome Project was completed in 2003 with the following goals: • identify all the approximately 20,000-25,000 genes in human DNA, • determine the sequences of the 3 billion chemical base pairs that make up human DNA, • store this information in databases, • improve tools for data analysis, • transfer related technologies to the private sector, and • address the ethical, legal, and social issues (ELSI) that may arise from the project.

6. The Encyclopedia of DNA Elements (ENCODE) Consortium is an international collaboration of research groups funded by the National Human Genome Research Institute (NHGRI). The goal of ENCODE is to build a comprehensive parts list of functional elements in the human genome, including elements that act at the protein and RNA levels, and regulatory elements that control cells and circumstances in which a gene is active (pilot phase completed in 2007, production phase ongoing).

7. Biomedical Genetics and Genomics is the field of study that seeks to understand the structure and function of all genes in an organism based on knowing the organism's entire DNA sequence. next-generation DNA sequencing

9. DNA is the Genetic Material • Griffin– genetic transformation in bacteria 1928 Streptococcus pneumoniae and mice. • Avery, MacLeod and McCarty – 1944 DNA is the transforming material. • Hershey and Chase – 1952 S35 and P32 DNA is the genetic material – phage T2, E. coli. • Watson and Crick – 1953 Double helical structure of DNA.

10. DNA is the genetic material Molecular structure of the DNA double helix in the standard B form Anti-parallel 5’ 3’ and 3’ 5’ A-T, C-G

11. DNA Structure and Replication DNA replication is semi-conservative, the two main steps are: • 1) To unwind the parent strands • Helicases, topoisomerase and SSBs (single-stranded binding proteins) • 2) To synthesize new DNA strands • Primase that forms RNA-DNA hybrids • DNA polymerase III that adds nucleotides • DNA polymerase I that fills in the gaps • Ligase • Telomerase • DNA polymerase that proof reads

12. The Central Dogma: Overview

14. 5’-P 3’-OH 3’-OH 5’-P The Central Dogma: Transcription • Initiation: Promoter and enhancer DNA sequences. • Elongation: RNA polymerase I (rRNA), II (mRNA) and III (tRNA and small rRNA). • Termination: Different specific sequences. • Post-transcriptional modifications. sense strand antisense strand sense 3’-OH 5’-P Polypeptide sequence Nt  Ct The antisense DNA strand serves as template for the RNA that is sense

15. The Central Dogma: The Genetic Code Triplet of NTPs (codons) that encode for a particular amino acid.

16. The Central Dogma: Translation • The steps: • Initiation. • Elongation. • Termination and Post-translational modifications. • The players: • Amino acids • Ribosomes (rRNA and proteins) that move along mRNA to translate it into a polypeptides. • tRNA  carry amino acid to ribosomes.

17. The Central Dogma: PAH gene Transcription and Translation Phenylalanine hydroxylase (PAH) deficiency results in intolerance to the amino acid phenylalanine and produces a spectrum of disorders including phenylketonuria (PKU).

18. Mutations

21. Gene Therapy: adenosine deaminase (ADA) deficient severe combined immunodeficiency (SCID). Dietary Modification: low phenyl alanine food.

22. Review Problems

23. 1) An organism is discovered in which the promoter sequence in the template strand is 3’-TTTTT-5’, the transcript begins with the first nucleotide following the promoter sequence, and transcription terminates immediately prior to the sequence 3’-GGGGGG-5’ in the template strand. The primary transcript is capped and used directly for the mRNA, and translation is initiated by scanning from the 5’ end. 3’-TTTTTATGGTACAGTTTGTCGCATACCATCGTCACATTGGGGGG-5’ What pre-mRNA sequence would be transcribed form the DNA sequence above? Where would the 5’-Cap be? Circle it on the previous sequence and explain its role below. Assuming no intron, what polypeptide chain would result from translation? A guanine is inserted just upstream of the second codon, what mutation is generated? What happens to the open reading frame? From the sequence in “d”, the guanine in the last codon is removed? What mutation is generated? What happens to the open reading frame?

24. 2) The gene for the human peptide hormone somatostin is completely contained in anEcoRI fragment (5’ G^AATTC 3’), which can be cut out from the largest fragment shown below. • 5’ GCCG^AATTCGATCCTATCAACACGAAGTGAAAGTCTTACAACCCATG^AATTCGATTCG 3’ • 3’ CGGCTTAA^GCTAGGATAGTTGTGCTTCACTTTCAGAATGTTGGGTACTTAA^GCTAAGC 5’ • A) What strand (top or bottom) is used as the coding strand? • Bottom • Top • Explain • B) How many codons does the polypeptide have? • 6 • 7 • 8 • 9 • 10 • Explain

25. Genes and Proteins Inborn errors of metabolism (defective enzymes) can cause hereditary disease. Garrod (1908) found blocks in metabolic pathways can cause disease: Alkaptonuria (AKU) or black urine disease is a rare condition in which a person's urine turns a dark brownish-black color when exposed to air because homogentisic acid builds up in the body. HGD (homogentisate oxidase)

27. Phenylketonuria (PKU) is a rare condition in which a person is born without the ability to properly break down an amino acid phenylalanine because of a mutation in the gene encoding phenylhydroxylase (PAH)

28. Genetic Analysis: Link between biochemistry and genetics Beadle and Tatum obtained mutants of the filamentous fungus Neurospora crassa by exposing asexual spores to x-rays or ultraviolet light.

29. Much our understanding of the relationship between proteins and genes has come from study of a fungus, Neurosporacrassus. which led to the formulation of Beadle and Tatum's so called 'one gene one enzyme' hypothesis.

30. Mutants screen conducted: • Minimal Medium (MM) containing only inorganic salts, a carbon source, and water (minimal necessities for growth of the wild-type). • Complete Medium that is enriched with a variety of amino acids, vitamins and other substances (growth requirements of all strains).

31. What gene is mutated? What is the sequence of enzymatic reactions?

33. Genetic Analysis: Complementation Data Complementation Data Analysisasks if two putative alleles, when in the same cell and acting independently (no recombination to form WT strains) can supply all functions necessaryfor a wild-type phenotype. Thus, complementation is a test of function and asks if mutations are in the same or different genes. Each nucleus contributes a non-mutant form of one or the other polypeptide chain, and so the heterokaryon is able to grow in minimal medium. Both nuclei contribute a mutant form of the same polypeptide chain; hence, no non-mutant form of that polypeptide can be synthesized and the heterokaryon is unable to grow in minimal medium.

34. x1-x6 are six mutant strains in Class III grown on MM.

35. Complementation groups can be generated, each of which represents a single gene needed for arginine biosynthesis A gene is then defined as a set of mutations that make up a single complementation group. Any pair of mutations within a group fail to complement one another.

36. Genes and the Environment Chromosomal disorders:result from numerical or structural changes in nuclear chromosomes. Mitochondrial disorders:relatively rare and result from mutations in mitochondrial DNA. Single-gene (monogenic) disorders:caused by mutations that occur in the DNA sequence of one gene. There are more than 6,000 known single-gene disorders, which occur in about 1 out of every 200 births. Multifactorial disorders:caused by a combination of environmental factors and mutations in multiple genes. Examples include heart diseases, high blood pressure, Alzheimer's disease, arthritis, diabetes, cancer, and obesity.

37. Genetic heterogeneity refers to genetic disorders which are caused by more than one single genetic factor and may have various phenotypes: • Allelic heterogeneity: Many mutations in the same gene causing the same disease (1400 mutations in the CFTR gene leading to Cystic Fibrosis). • Locus Heterogeneity: Many mutations in different genes expressed at different loci (at least 35 genes for Retinitis pigmentosa). • Phenotypic heterogeneity (Pleiotropy): Different mutations in the same gene leading to different phenotypes Sickle cell anemia).

38. The Molecular Unity of Life All living forms are closely related forming a molecular unity of life through the three Domains: Bacteria, Archaea, Eukarya

39. The molecular unit of life is seen by comparing genomes and proteomes

40. Review Problems

41. Questions 1 and 2 refer to the following passage • A metabolic pathway is studied where P is the original precursor, Z is the final vitamin product, and W, X and Y are known intermediate products. You perform some mutants screen experiments and obtain results shown in the following table. • Also, you know that: • class I mutants (mutant 5) generate the final product Z. • class II mutants (mutants 1, 3, 4, 6 and 7) generate the metabolite X • class III mutants (mutant 2) generate the metabolite W • class IV (mutants 8, 9 and 10) mutants generate the metabolite Y • Question 1: (2.5 points) • The linear metabolic pathway starting with P on the left and ending with Z on the right is: • P, W, Y, X, Z • P, Y, X, W, Z • P, X, Y, W, Z • P, X, W, Y, Z • P, Y, W, X, Z • Explain (2.5 points) • Write the metabolic path with intermediates and corresponding mutant classes.

42. Question 2: (2.5 points) • The ten mutants were tested for complementation in all pairwise combinations using heterokaryons and the results are shown in the following matrix. • Which of the following sequence is correct as it pertains to the number of different genes per class of mutants? These numbers have to be analyzed in the context of the sequence of metabolites previously defined. • 2, 1, 1, 4 • 3, 1, 1, 2 • 1, 1, 2, 3 • 2, 3, 1, 1 • 3, 1, 2, 1 • Explain (2.5 points)