1 / 36

Goal 3.04 Assess the impacts of genomics on individuals and society.

Goal 3.04 Assess the impacts of genomics on individuals and society. There are many ways that humans have manipulated genes. blog.makezine.com. Let’s look at a few of these…. scrapetv.com. 1. Artificial Breeding/Selection. Artificial Breeding/Selection is ….

wayne-norman
Download Presentation

Goal 3.04 Assess the impacts of genomics on individuals and society.

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Goal 3.04 Assess the impacts of genomics on individuals and society. There are many ways that humans have manipulated genes. blog.makezine.com Let’s look at a few of these… scrapetv.com

  2. 1. Artificial Breeding/Selection Artificial Breeding/Selection is … When humans select who mates to whom to improve the breed. z.about.com michaeldodsracing.co.uk

  3. Artificial Breeding/Selection Wild mustard plant Artificial Breeding/Selection is … Wild corn called TEOSINTE was bred to create today’s corn When humans select which plants to cross to improve the plant. Wild rose plant nescent.org

  4. Artificial Breeding/Selection What if humans selected which humans to mate?! www.enjoyfrance.com static.howstuffworks.com ? Angelina Jolie? Mother Teresa? gandt.blogs.brynmawr.edu 2009.wimbledon.org Venus Williams? Rosalind Franklin?

  5. 2. BIOTECHNOLOGY Biotechnology is … The use of organisms or their products to improve human life. HOW DO THEY DO IT?! biotechresearchandfinance.com

  6. The code is UNIVERSAL! • Since all living organisms… • use the same DNA • use the same code book • read their genes the same way Remember that ALL organisms are made using the same four DNA bases A,T,C,G. AND Those bases code the same way in ALL organisms using A,U,C,G.

  7. CLONING = making genetically identical copies The Controversy Reversing Human Destruction through Cloning http://player.discoveryeducation.com/index.cfm?guidAssetId=4CDB02CD-6421-42B4-AF9D-B940E1393F19&blnFromSearch=1&productcode=US HSW: Genetics: CloningTime: 03:20

  8. Let’s look at Dolly

  9. Human Genome Project Identified the entire sequence of DNA bases for humans. There are 3.2 billion bases in the human genome. What do you think can be done now that we know the order (sequence) in which all 3.2 billion bases occur? Human Genome Project Explained 15:24 min http://www.5min.com/Video/The-Human-Genome-Project-Applications-151426688

  10. KARYOTYPE = display of chromosomes laid out in pairs from largest to smallest. Sex chromosomes are always placed at the end. How many chromosomes do you see? 46 chromosomes (23 pairs)in this human organism Now, how many chromosomes do you see? Is this a male or female? IT’S A GIRL!

  11. How many chromosomes? Which gender (sex)? How many chromosomes? Which gender (sex)? 46 chromosomes 23 pairs It’s a BOY!

  12. Karyotypes are a way or organizing chromosomes to make it easier to study and identify certain characteristics within an individual’s DNA. Make a Karyotype http://learn.genetics.utah.edu/content/begin/traits/karyotype/ How scientists and doctors use karyotypes http://learn.genetics.utah.edu/content/begin/traits/predictdisorder/

  13. What do you get when you cross … instanta.blogspot.com i57.photobucket.com clouddragon.wordpress.com Genetic Engineering is… Inserting genes from one organism into a different organism. smh.com.au www.scienceclarified.com www.chemcases.com

  14. How do we do mix genes?? • Genetic engineering • find gene • cut DNA in both organisms • paste gene from one creature into other creature’s DNA • insert new chromosome into organism • organism copies new gene as if it were its own • organism reads gene as if it were its own • organism produces NEW protein: Remember: we all use the same genetic code!

  15. Cutting DNA • DNA “scissors” • enzymes that cut DNA • Restriction Enzymes • used by bacteria to cut up DNA of attacking viruses • EcoRI, HindIII, BamHI • cut DNA at specific sites • enzymes look for specific base sequences ACTGA ATTCGGATCA TGACTTAAGCC TAGT

  16. GTAAC GAATTCACGCTT CATTGCTTAAG TGCGAA Restriction enzymes  • Cut DNA at specific sites - leave “sticky ends” Locate the section of gene we want. Restriction Enzyme restriction enzyme cut site DNA double strand. GTAACGAATTCACGCTT CATTGCTTAAGTGCGAA restriction enzyme cut site 

  17. RecombiningDNA – Use the sameenzymes for both pieces. • leave “sticky ends” on both • can glue DNA together at “sticky ends” Cut the gene you want. GTAAC GAATTCACGCTT CATTGCTTAAG TGCGAA Cut the chromosome you want to add the gene to. GTAAC GAATTCACGCTT CATTGCTTAAG TGCGAA DNA Ligasejoins the ends. Use “sticky ends” to glue the two genes together. GAATTCACGCTT TGCGAA GTAAC CATTGCTTAAG Recombinant DNA:DNA with foreign genes inserted.

  18. Why use Bacteria?? How can bacteria read human DNA? • Recombined Gene produces needed protein in a different organism. • Use Bacteria because it reproduces rapidly and is one-celled so easy to grow. 100 minutes 200 minutes 20 minutes 60 minutes 6 hours 160 bacteria 10 bacteria 40 bacteria 1,310,720 bacteria 5120 bacteria

  19. Bacterial DNA and plasmids • Single circular chromosome • only one copy = haploid • no nucleus • Other DNA = plasmids! bacterialchromosome plasmids

  20. How can plasmids help us? transformedbacteria gene fromother organism recombinantplasmid cut DNA vector plasmid • A way to get genes into bacteria easily • insert new gene into plasmid • insert plasmid into bacteria = vector • bacteria now expresses new gene • bacteria make new protein + glue DNA

  21. Grow bacteria…make more transformedbacteria gene fromother organism recombinantplasmid + vector plasmid growbacteria harvest (purify)protein

  22. Virtual Lab 12:Bacterial Transformation-Ampicillin Resistance

  23. Other uses of Genetic Engineering: • Genetically modified organisms (GMO) • enabling plants to produce new proteins • Produce medications: insulin • Used by diabetics • Extend growing season: fishberries • strawberries with an anti-freezing gene from flounder • Improve quality of food: golden rice • rice producing vitamin A

  24. Genetic Engineering and Medicine Gene Therapy = using genetic engineering to combat disease. Hemophilia – patients suffer from a lack of Factor VIII.

  25. Stem Cells…the key to our future? Heart Cells to repair damaged heart tissues. Red Blood Cells for accident victims and transfusions. Muscle Cells to repair damaged or weak muscles. Stem Cells

  26. Stem Cells

  27. Biotechnology Gel Electrophoresis http://videos.howstuffworks.com/hsw/11820-genetics-using-dna-evidence-to-solve-crimes-video.htm

  28. Many uses of restriction enzymes… • Now that we can cut DNA with restriction enzymes… • we can cut up DNA from different people… or different organisms… and compare it • why? • forensics • medical diagnostics • paternity • evolutionary relationships • and more…

  29. Comparing cut up DNAGel Electrophoresis • How do we compare DNA fragments? • separate fragments by size • How do we separate DNA fragments? • run it through a gelatin • gel electrophoresis • How does a gel work? http://www.dnatube.com/video/701/DNA-Fingerprinting

  30. Gel electrophoresis • A method of separating DNA in a gelatin-like material using an electrical field • DNA is negatively charged • when it’s in an electrical field it moves toward the positive side DNA        – + “swimming through Jello”

  31. Gel electrophoresis • DNA moves in an electrical field… • so how does that help you compare DNA fragments? • size of DNA fragment affects how far it travels • small pieces travel farther • large pieces travel slower & lag behind DNA        – +

  32. Running a gel fragments of DNAseparate out based on size cut DNA with restriction enzymes 1 2 3 Stain DNA • ethidium bromide binds to DNA • fluoresces under UV light

  33. Virtual Lab 11Restriction Enzyme Cleavage and Electrophoresis Lab: Electrophoresis

  34. DNA Fingerprinting • Why is each person’s DNA pattern different? • sections of “junk” DNA • doesn’t code for proteins • made up of repeated patterns • CAT, GCC, and others • each person may have different number of repeats • many sites on our 23 chromosomes with different repeat patterns GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTT CGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

  35. 1 2 3 4 5 1 2 3 4 5 Uses: Evolutionary relationships • Comparing DNA samples from different organisms to measure evolutionary relationships turtle snake rat squirrel fruitfly – DNA  +

  36. Sequencing DNA: http://www.pbs.org/wgbh/nova/genome/sequ_flash.html

More Related