320 likes | 361 Views
Explore the advancement in HLA-universal platelet research for regenerative purposes and their potential in treating thrombocytopenia, wound healing, and tissue remodeling. Learn about the innovative strategies to reduce organ immunogenicity and prevent rejection, paving the way for universal cells and tissues in regenerative medicine.
E N D
Generation of HLA universal platelets for regenerative applications Constança FigueiredoInstitute for Transfusion Medicine, Hannover Medical School, Hannover, Germany
HLA loci are the most polymorphic of the entire human genome IMGT/HLA database 12.672 HLA alleles A mean of 450 new alleles/ Year
Structure of HLA class I and II molecules HLA Class I HLA Class II HLA-A HLA-B HLA-C HLA-DR HLA-DP HLA-DQ
The function of HLA molecules Antigen presentation Efficient immune response against pathogens and cancer cells
HLA variability is the major hurdle for transplantation • HLA Antigens = Major Antigens • Non-HLA Antigens = Minor Antigens = Presented Peptides MHC/non-MHC Mismatch Immune response (humoral/cellular) Rejection
Standard Strategy to prevent rejection: Immunosuppression Suppression of the recipient’s immune system
Aim Control HLA expression in a allele-, gene- or class-specific way. In a clinical setting, this would allow to 1. develop tissues with low or no immunogenicity. 2. decrease the risk of HLA-mediated post-transplant tissue/organ failure.
Universal cells and tissues Competent Immune System Tissue (invisible) HLA TCR
Alternative Strategy to prevent rejection: Reducing the organ‘s immunogenicity Reducing the organ’s Immunogenicity
Synthetic siRNA duplex Cellular kinase siRNA duplex Single-stranded siRNA in RNA-induced silencing complex (RISC) Translational Block Mechanism Cleavage Mechanism Gene silencing by RNA interference (RNAi): Small interfering RNA (siRNA) Andrew Fire Stanford University mRNA mRNA Craig Mello University of Massachusetts Nobel Prize 2006
Silencing of β2-microglobulin in rat Lew fibroblasts Figueiredo et al. BioMed Res Int, 2013
MHC silencing prolongs graft survival after allogeneic transplantation Figueiredo et al. BioMed Res Int, 2013
Role of platelets • Maintain Haemostasis • Secretory functions • Modulation of immune responses • Regulate proliferation
Application of platelets in regenerative medicine • Treatment of thrombocytopenia • Wound healing • Tissue remodelling • Drug carriers
TPO receptor agonists Allogeneic platelets Ex-vivo induced megakaryocyte progenitors Thrombocytopenia Characteristics • Low platelet number • Major bleeding complications HLA-universal platelets Treatment options • Alloimmunization against HLA class I antigens • Platelet refractoriness due to HLA antibodies
In vitro production of Platelets to treat platelet transfusion refractoriness
Thrombopoiesis IL-6, IL-11 Stem cell factor (SCF), IL-3 Thrombopoietin (TPO) Cell division Platelets Endomitosis MEP CFU-MK Promegakaryoblast Megakaryocyte Proplatelet producing megakaryocyte CD41 (GPIIb/IIIa) CD42a (GPIX), CD42b (GPIb)
H1 shRNA EF1a GFP T C A T 5′- GAATGGAGAGAGAATTGAA A 3′- TTCTTACCTCTCTCTTAACTT G A A G Silencing HLA expression HLA class I-specific silencing Figueiredo et al, J mol Med, 2006 Figueiredo et al, Transfusion, 2007 Figueiredo et al, BioMed Res Int, 2013 Wiegmann & Figueiredo et al, Biomaterials, 2014
HLA class I silencing 64% Polyploidy of differentiated megakaryocytes CD41+ shRNA_NS CD41+ shRNA_β2m PBMCs 2n 33% 0,1% 35% 4n 8n Cell count 16n PI
NC shNS shβ2m white bar = 50μm shβ2m isotype shNS 33.7 % 0.0 % 29.5 % CD42a CD61 ProPLT/ PLT-production by differentiated MKs ProPLTs PLTs shβ2m + ADP shNS shNS + ADP 29.4% 2.0% 25.1% Cell count PAC-1 (n = 4) Gras & Figueiredo et al. Hum Gen Ther, 2013
shβ2m HLA-universal MKs protected from antibody-mediated cytotoxicity NC PC aHLA03 shNS (n = 4, ***p<0.001)
HLA-universal MKs & PLTs prevent PLT refractoriness in a mouse model antiHLA ab NSG NSG shNS ab + shNS shβ2m NC (ab only) ab + shβ2m
Isotype control shNS shβ2m huCD42a ab + shNS NC (ab only) ab + shβ2m huCD61 HLA-universal PLTs prevent PLT refractoriness in a mouse model Human PLTs in the circulation of NSG mice (n = 3, *p<0.05, **p<0.01) Gras & Figueiredo et al. Hum Gen Ther, 2013
Induced pluripotent Stem (iPS) cells as unilimited cell sources Yamanaka S. Nature Medicine 2009.
Differentiation of iPSCs toward HLA-universal PLTs Silencing HLA expression iPSC cultured in monolayer iPSC colony Orbital shaker Megakaryocyte and Platelet formation Mesoderm Megakaryocytes BMP-4 VEGF Xenofree conditions Hematopoiesis/MK TPO SCF IL-3TPO
Generation of HLA-universal iPSC lines shNS shß2m NC shβ2m Counts Monolayer in Laminin SSEA4 Counts Tra-1-60
Generation of HLA-universal Megakaryocytes MKs day 12 isotype 7.3 % 0.2 % CD42a day 26 day 19 44.6 % 82.1 % CD41
Differentiation of Platelets NS shβ2m 13.4 % 18.6 % CD42a CD61
iPSC-derived Platelets respond to external stimuli Non-stimulated ADP + Thrombin Counts CD62P
Large-scale production of platelets in bioreactors MKs membrane PLTs 23.8 % CD 42a CD61
Summary • The generation of in vitro pharmedgeneticallymodifiedplateletsisfeasible. • IPSC serveas an unlimitedcellsourceforthe large-scaleproduction of platelets. • Universal platelets bring theconcept of Universal cellsonestepclosertoreality.
Acknowledgements Institute for Transfusion Medicine, Hannover Medical School, Germany. Rainer Blasczyk Dominca Ratuszny Laura Schlahsa Haijiao Zhang Ann-Kathrin Börger Stefanie Vahlsing Lilia Goudeva Helmholtz Center for Infection Research, Braunschweig, Germany Carlos Guzman Kai Schulze Institute of Experimental Hematology, Hannover Medical School, Hannover Thomas Moritz, Axel Schambach Nico Lachmann Mania Ackermann LEBAO, Hannover Medical School, Hannover Ulrich Martin Stefanie Wunderlich Lena Engels Stiftung für Transfusionsmedizin