1 / 12

Werkzitting II Prof. F. Claessens

Werkzitting II Prof. F. Claessens. Definities. Escherichia coli. Bacteriofaag. Attenuatie. P romotor. N ucleosoom. Wobble. Nucleotide excision repair. Leucine zipper. Meerkeuzevragen :. Een mRNA heeft 1, 2, 3 of 4 leesramen. AUG GCC CAG GCU A. A UGG CCC AGG CUA.

zachery-guthrie
Download Presentation

Werkzitting II Prof. F. Claessens

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Werkzitting II Prof. F. Claessens

  2. Definities Escherichia coli Bacteriofaag Attenuatie Promotor Nucleosoom

  3. Wobble Nucleotide excision repair Leucine zipper

  4. Meerkeuzevragen: Een mRNA heeft 1, 2, 3 of 4 leesramen. AUG GCC CAG GCU A A UGG CCC AGG CUA AU GGC CCA GGC UA Een DNA strengheeft 2, 4, 6 of 8 leesramen.

  5. Een monomeer DNA-bindend domein contacteert meestal ongeveer_____ A. Één bp B. 12 bps C. 6 bps D. 2 bps Welke component staat in voor de herkenning van de ribosoom-bindingsplaatsen? eIFs B. tRNAi C. 23S rRNA D. 16S rRNA De regeling van de expressie van het lactose operon door een tekort aan glucose, wordt ___genoemd. A. De-repressie B. Activatie C. Attenuatie D. Repressie

  6. Welke van dezevier is GEEN codon voor Arginine? CGA CGU AGA AGU

  7. A B C D B C D B C D F E EE Duidtaan: 5’UTR 3’UTR ORF Startcodon Stopcodon RBS Hieronderstaat de sequentie van het eerste exon van een gen. Geef de eersteaminozuren van het eiwitdathierdoorgekodeerdwordt GCCGGATATGCCAATATGCTTTCCCGGG…

  8. GCCGGAU AUG CCA AUA UGC UUU CCC GGG…

  9. Uiteenkleinehoeveelheid van eeneiwithebt u de volgendefragmentenkunnenidentificeren: Ontwerpeen oligonucleotide die als probe kandienenom het mRNA datvoorditeiwit teidentificeren LeuSerArgLeuArg Trp Met His His Lys

  10. LeuSerArgLeuArg Trp Met His His Lys

  11. Wat is het effect van dezemutatie? • De insertie van één nucleotide nabij het einde van een mRNA • Deletie van één nucleotide in de eerstetwintig codons van een ORF • Deletie van drieopeenvolgendenucleotidenmiddenineen ORF • Eenmutatie van de onderlijnde C in GCCGGAU’AUG’CCA’AUA’UGC… • naar U, • naar G • naar A

  12. Het DNA fragment tussen de twee pijlen moet worden geamplificeerd. Welke DNA primers zou u daar voor nemen? AGGCTATATAATTTAAGCTAGATACCAGATAGATACCCCaCCAA AAGTCATCAGTATaaaGATCAGATcaggtcccgaattacggtc tgttcttaacgagttattcccgccgtaatacatggtacctgaca AGGCTATATAATT TAAGCTAGATACC ATTCGATCTATGG AATTATATAGCCTT TACATGGTACCTGACA ATTACGGCGGGAA TTCCCGCCGTAAT CAGGTACCATAGTA

More Related