1 / 14

killer vegetables, animal-human hybrids, other scary stuff.

killer vegetables, animal-human hybrids, other scary stuff. KEVIN HIOM. Galway 2010. Chapter 1: Epistasis for beginners. Basic principles of DT40. DT40: A genetically tractable eukaryotic cell line. DT40. Genetically tractable Good model for genome stability in mammals

berke
Download Presentation

killer vegetables, animal-human hybrids, other scary stuff.

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. killer vegetables, animal-human hybrids, other scary stuff. KEVIN HIOM Galway 2010 Chapter 1: Epistasis for beginners Basic principles of DT40

  2. DT40: A genetically tractable eukaryotic cell line DT40 • Genetically tractable • Good model for genome stability in mammals • Complementation by human genes • Good database versus humans

  3. Genetically tractable DT40 Phenotypic analysis Knocking out or mutating genes and looking at cellular function Mapping genetic pathways Combining mutations- epistasis Structure/function analysis/ cell biology Complementation, proteomics Genetic regulation Reporter assays All these require manipulation of the genome

  4. Integrate DNA Target DNA * Alter DNA * Remove DNA

  5. Genetic Recombination is our tool Random Integration- non homologous end joining Targeted Integration- Homologous/Homeologous recombination Site specific recombination

  6. Non Homologous End Joining-Random integration Ku, DNA-PKcs, LigIV, Advantages Disadvantages Simple Relatively high frequency Potential uncharacterised genetic effect Multiple integration Shut down of expression

  7. Homologous recombination- site specific integration, gene disruption, mutation DNA End Resection Mre11/RAD50/NBS1, CtIP, Exo1 Strand Invasion RAD51 Branch Migration RAD51BCD Holliday Junctions Resolution Slx1/4, GEN1

  8. Homologous recombination

  9. Homologous Recombination Advantages Acurate/error free Introduction of multiple changes Disdvantages Easy to introduce errors Aberrant recombination Neighbouring sequences Epistasis difficult for HR genes

  10. Site specific recombination- cre/lox ATAACTTCGTATAGCATACATTATACGAAGTTAT LOXP

  11. Site specific recombination- re-using antibiotic resistance drugr Cre recombinase synapsis excision

  12. Site specific recombination Courtesy of the National Library of Medicine (NLM)

  13. Understanding recombination is the key to manipulating the DT40 genome

  14. Words of warning 3 copies of chromosome 2 Genomes are ‘plastic’- Don’t culture for too long

More Related