1 / 23

DNA Fingerprinting

DNA Fingerprinting. DNA Fingerprints. Discovered in 1984 by Alec Jeffreys. Much of human DNA sequence is similar. Varies in numbers of repeats within non-coding sections of DNA (‘minisatellites’). Minisatellites. Basic method. DNA extracted from sample and amplified by PCR

bthrockmorton
Download Presentation

DNA Fingerprinting

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA Fingerprinting

  2. DNA Fingerprints Discovered in 1984 by Alec Jeffreys. Much of human DNA sequence is similar. Varies in numbers of repeats within non-coding sections of DNA (‘minisatellites’).

  3. Minisatellites

  4. Basic method • DNA extracted from sample and amplified by PCR • Restriction enzymes used to cut it into fragments • Fragments separated by gel electrophoresis • Fragments treated with radioactive probe which can be captured on X-ray film • The result will be a pattern of more than 30 stripes, resembling a 'bar code'

  5. Genetic fingerprinting

  6. First DNA fingerprints… Relied on RFLPs Restriction Fragment Length Polymorphisms Differences in lengths of DNA fragments (after cutting by restriction enzymes) due to differences in numbers of repeated sequences of bases. The probe used binds to the repeated sequence so different sized fragments of DNA can be compared.

  7. Current Method • Relies on STRs (short tandem repeats). • 2-5 base pairs repeated a number of times in succession, e.g. GATAGATAGATAGATAGATA • Number of copies varies from one person to another.

  8. Current Method • 13 STR loci are currently used in DNA fingerprints • Allows smaller, more degraded samples to be analysed. • Chance of two people having identical STR-based DNA fingerprints is around 1 in a billion.

  9. Analysing genetic fingerprints A profiler can inspect genetic fingerprints by eye to make quick comparisons. This can be a useful tool in forensic science. The process can also be automated with a computer using the marker bands to calculate the size and distance travelled by the bands in the profile. It is sometimes necessary to consider the odds that somebody else in the population has the same DNA fingerprint as the one being studied. For instance, to assess the risk of a false criminal conviction.

  10. The devil is in the detail! • The 5’ prime and 3’ prime ends of the bases must be round the right way! IMPORTANT: Do not take bases apart!!!

  11. Correct base pairing is critical! • Green (Guanine) pairs with yellow (Cytosine) • Blue (Adenine) pairs with orange (Thymine)

  12. Using primers to determine PCR product size Primer set 1 Primer set 2

  13. Lesson Part One – STR identification • Group 1 and 2 will work out the number of repeats of one STR located on chromosome 16. • At this locus people have between 5-16 copies of the STR giving different sized products. • The length of the PCR product allows you to count how many copies of the STR repeat are present.

  14. Group 1 – STR analysis • Make the double stranded DNA template using bases with black sugars. Remember to get the 5' to 3' orientation correct! • Denature the two strands by separating them. • Anneal single stranded primers to the complementary bases - one primer per strand. • Work out the length of the final PCR product. How many copies of the STR repeat do you have? Optional extension – use parts from PCR Puzzle to make a model of the double stranded PCR product using bases with red sugars.

  15. DNA Sequence Denature PCR product Anneal primers

  16. Group 2 – STR analysis • Make the double stranded DNA template using bases with black sugars: • Denature the two strands by separating them. • Anneal single stranded primers to the complementary bases - one primer per strand. • Work out the length of the final PCR product. How many copies of the STR repeat do you have? Optional extension – use parts from PCR Puzzle to make a model of the double stranded PCR product using bases with red sugars.

  17. DNA Sequence Denature PCR product Anneal primers

  18. Lesson Part Two - Gender determination • Group 3 and 4 look at gender • X chromosome has a short deletion • Y chromosome does not have the deletion • Male & female give different size PCR products • You can visualise these on an electrophoresis gel

  19. How to determine gender from these results Think about how male and female DNA will appear on an electrophoresis gel. • A female will have XX chromosomes so you get one band on a gel as both give the same size PCR product • A male will have XY chromosomes so you get two bands of different sizes on a gel

  20. Group 3 – Gender chromosome • Make the double stranded DNA template using bases with black sugars. • Denature the template by separating the strands. • Anneal single stranded primers to the complementary bases - one primer per strand. • Work out length of the final PCR product. Optional extension – use parts from PCR Puzzle to make a model of the double stranded PCR product using bases with red sugars.

  21. DNA Sequence Denature PCR product Anneal primers

  22. Group 4 – Gender chromosome • Make the double stranded DNA template using bases with black sugars. • Denature the template • Anneal single stranded primers to the complementary bases - one primer per strand. • Work out length of the final PCR product. Optional extension – use parts from PCR Puzzle to make a model of the double stranded PCR product using bases with red sugars.

  23. DNA Sequence Denature PCR product Anneal primers

More Related