1 / 22

DNA Fingerprinting

DNA Fingerprinting. A method of developing a person’s DNA “profile,” similar to a fingerprint. Pioneered in England in 1984 by Dr. Alec Jeffreys. Dr. Alec Jeffreys. First Forensic Use. First used by law enforcement in England in the mid-1980’s.

chinue
Download Presentation

DNA Fingerprinting

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA Fingerprinting • A method of developing a person’s DNA “profile,” similar to a fingerprint. • Pioneered in England in 1984 by Dr. Alec Jeffreys Dr. Alec Jeffreys

  2. First Forensic Use • First used by law enforcement in England in the mid-1980’s. • DNA evidence exonerated one man, and convicted another. • Described in The Blooding, by Joseph Wambaugh

  3. How does it work? • 99.9% of your DNA is the same as everyone else’s. • The 0.1% that differs are a combination of: • Gene differences (Differences in the genes themselves) • Differences in “polymorphic regions” between the genes on the DNA.

  4. How does it work? • Certain points between the genes on the DNA have repeating base sequences. • For example:ATTACGCGCGCGCGCGCGCTAGC • These are called short tandem repeats (STRs for short)

  5. How does it work? • Everyone has STRs at the same place in their DNA, but they are different lengths for different people. • For example:Person 1: ATTACGCGCGCGCGCGCGTAGC (7 repeats)Person 2: ATTACGCGCGCGCGTAGC (5 repeats)

  6. To Make a DNA Fingerprint… • First, we use restriction enzymes to chop the DNA up into millions of fragments of various lengths. • Some of the fragments contain STRs; some do not. The ones that do are different lengths for different people.

  7. Restriction Fragment Length Polymorphisms (RFLPs) • Polymorphisms are slight differences in DNA sequences as seen in individuals of the same species

  8. To Make a DNA Fingerprint… • Next, we use gel electrophoresis to sort the DNA fragments by size.

  9. Gel Electrophoresis • Method for sorting proteins or nucleic acids on the basis of their electric charge and size

  10. Gel Electrophoresis • Electrical current carries negatively-charged DNA through gel towards positive electrode • Agarose gel sieves DNA fragments according to size • Small fragments move farther than large fragments

  11. Gel Electrophoresis

  12. Restriction fragmentpreparation 1 Restrictionfragments Gel electrophoresis 2 Blotting 3 Radioactive probe 4 Probe Detection of radioactivity(autoradiography) 5 Film Figure 12.11C To Make a DNA Fingerprint… • Finally, a radioactive probe attaches to our STRs. Only the fragments with our STRs will show up on the gel.

  13. To Make a DNA Fingerprint… • Since STRS are different lengths in different people, this creates a DNA Fingerprint.

  14. Two uses for DNA Fingerprints... • ForensicsDNA taken from crime scenes (blood, semen, hair, etc.) can be compared to the DNA of suspects.Real-life CSI!

  15. Two uses for DNA Fingerprints... • ForensicsThis is an example of a gel that might be used to convict a rape suspect. Compare the “Sperm DNA” to the “Suspect DNA.” Which suspect committed the rape?

  16. Two uses for DNA Fingerprints... • Paternity TestingSince all of our DNA markers came from either mommy or daddy, we can use DNA fingerprints to determine whether a child and alleged father are related…just like on Maury Povich!

  17. Two uses for DNA Fingerprints... • Look at the two “Child” markers on this gel. Can they both be matched up to either the mother or the “alleged father?” • Yes. This is a “positive” test for paternity.

  18. Two uses for DNA Fingerprints... • How about this gel? Do both of the child’s markers match either the mother or the “alleged father.” • No! The “alleged father” is not this child’s biological parent.

  19. Interpreting DNA Fingerprints • Which child is not related to the mother? • Son 2 • Which children are not related to the father? • Daughter 2 and Son 2

  20. Interpreting DNA Fingerprints • A blood stain was found at a murder scene. The blood belongs to which of the seven possible suspects? Suspect 3

  21. Interpreting DNA Fingerprints • These DNA fingerprints are from a mother, a child, and two possible biological fathers. Which one is the daddy? 2nd alleged father

  22. The Polymerase Chain Reaction (PCR) • The polymerase chain reaction, PCR, can produce many copies of a specific target segment of DNA • A three-step cycle—heating, cooling, and replication—brings about a chain reaction that produces an exponentially growing population of identical DNA molecules

More Related