1 / 20

Central Dogma of Molecular Biology

Central Dogma of Molecular Biology. Talk with your table partner about answers to these: What is DNA’s job in a cell? What does it do? What is a “trait”? Name as many different traits that you can think of for a human being. Homework. Energy Test+ due Thursday. Objective & Central Question.

burke-osborne
Download Presentation

Central Dogma of Molecular Biology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Central Dogma of Molecular Biology Talk with your table partner about answers to these: What is DNA’s job in a cell? What does it do? What is a “trait”? Name as many different traits that you can think of for a human being.

  2. Homework • Energy Test+ due Thursday

  3. Objective & Central Question • How do you get from a string of 6 chemicals to all your physical characteristics, or all of a bacterium’s or all of a plant’s etc. • Today is to get a broad overview of the process. Protein synthesis = getting from DNA to a trait.

  4. Protein Synthesis • Synthesis • What does it mean to synthesize something? • Transcription • What does it mean to transcribe something? • Translation • What does it mean to translate something?

  5. Central Dogma = Protein Synthesis DNA ---> ______ ---> _________ ---> Trait

  6. Central Dogma = Protein Synthesis DNA ---> RNA ---> Protein ---> Trait Transcription Translation

  7. Protein Synthesis • Protein synthesis is also called getting “from genotype to phenotype.” • Genotype = your DNA sequence • Phenotype = the physical trait you have because of that DNA sequence

  8. RNA • RNA = Ribonucleic acid • Molecule made of nucleotides that assist DNA in giving orders.

  9. Compare & Contrast DNA RNA

  10. Macromolecules & Cell Parts Genetic material: “Blueprint” for cell Carbon, Nitrogen, Hydrogen

  11. Is it DNA or RNA? ATTCGCGTG TAAGCGCAC GCCUAUGCGGGA CCATCGGGCAAC

  12. Transcription • Starting from the beginning… • http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html

  13. Transcription • Transcription = a strand of mRNA is made using a strand of DNA as a template. • It happens in the nucleus. • The RNA strand is made by matching free-floating RNA nucleotides to the DNA strand sequence, making an RNA strand that’s perfectly complementary. • Which process that we’ve already learned does this remind you of? • mRNA = “Messenger RNA.”

  14. Transcription • Say that this is my DNA molecule. AATGCGATGCATGCTAAAGCTAGA TTACGCTACGTACGATTTCGATCT • During transcription, the two strands will unzip. • The strand that RNA is NOT made from = “gene strand.” • The strand that RNA IS made from = “template strand.”

  15. Transcription • What will the mRNA sequence be if the top strand is the template strand? AATGCGATGCATGCTAAAGCTAGA TTACGCTACGTACGATTTCGATCT • Which strand, gene or template, does the base sequence of the mRNA come out identical to? (Except that T = U)

  16. mRNA then leaves the nucleus, and goes to the ribosome. The rest of protein synthesis happens in the ribosome.

  17. Can you complete these questions? • ____ -> _____ -> ________ -> _______ • Also label the first two arrows. • Where does transcription take place in the cell? • If this DNA molecule undergoes transcription, write the RNA molecule that results, and label which strand of DNA you used for the template and which is the gene strand. Lastly, what KIND of RNA did you make? CGTTCGACTGATCGT GCAAGCTGACTAGCA

  18. Vocabulary • Protein synthesis • Genotype • Phenotype • Trait • Transcription • RNA • mRNA • Gene strand • Template strand

More Related