1 / 37

Introduction The Central Dogma of Molecular Biology

DNA. Transcription. Ribosome. mRNA. Translation. Polypeptide (protein). Introduction The Central Dogma of Molecular Biology. Cell. Protein Synthesis. Flow of Information : DNA RNA Protein Transcription Translation Transcription: DNA is copied into

ramiro
Download Presentation

Introduction The Central Dogma of Molecular Biology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA Transcription Ribosome mRNA Translation Polypeptide (protein) IntroductionThe Central Dogma of Molecular Biology Cell

  2. Protein Synthesis Flow of Information: DNA RNA Protein Transcription Translation Transcription: DNA is copied into messenger RNA (mRNA). This messenger brings code from nucleus to ribosome where translation occurs.

  3. Protein Synthesis Transcription process: DNA unzips and one strandserves as a template. The RNA bases attach to the DNA template, thusassembling mRNA. mRNA leaves the nucleus and travels to the ribosome in the cytoplasm.

  4. Cytoplasm Nuclear pores AAAAAA AAAAAA DNA Transcription RNA RNA Processing G G mRNA Export Nucleus Eukaryotic Transcription

  5. RNA Transcription Step 1: Hydrogen bonds between complimentary bases break DNA “unzips”

  6. RNA Transcription Step 2: DNA strands pull apart from each other

  7. RNA Transcription Step 3: RNA nucleotides in the nucleus match up with only one side of the “unzipped” DNA, the sense strand -each “unzipped’ strands forms a template for a mRNA strand RNA nucleotide

  8. RNA Transcription Step 4: RNA nucleotides continue to match up with “unzipped” DNA until the message is completely transcribed mRNA strand One side of DNA strand

  9. RNA Transcription mRNA strand Step 4: mRNA strand breaks off from the DNA strand One side of DNA strand

  10. RNA Transcription Step 5: mRNA strand leaves the nucleus for the ribosome

  11. RNA Transcription Step 6: Once the mRNA leaves, the DNA “zips” back together

  12. Protein Synthesis: Transcription Transcription transcription2

  13. Translation: at ribosomes • mRNA dictates the amino acid sequence of a protein. • 1 Strand RNA  Amino Acid Chain  Protein

  14. Translation process: Protein Synthesis: Translation:mRNA codes for a polypeptide chain orprotein. Each combination of 3 nucleotides on mRNA is called a codon: Each codon specifies a particular amino acid.

  15. Translation continued: Transfer RNA (tRNA): carries amino acids to mRNA in ribosome to assemble an amino acid chain – protein.

  16. tRNA molecules have 2 important sites of attachment. • One site, called the anticodon, binds to the codon on the mRNA molecule. • The other site attaches to a particular aminoacid.

  17. Methionine A C C 73 1 72 2 71 3 70 4 69 5 68 6 67 59 7 66 Py A* U* 65 64 63 62 C 16 Pu 17 9 A Pu 17:1 13 12 Py 10 49 50 51 52 G C T y G* Py 22 23 Pu 25 47:16 G A 26 47:15 20 20:2 20:1 27 1 43 44 28 42 45 46 29 41 47 30 40 47:1 31 39 Py* 38 U Pu* U 34 36 C 35 A Anticodon Met-tRNA What is the codon that this tRNA will bind to?

  18. Protein Synthesis: Translation What are the anti-codons that will bind to these codons?

  19. Protein Synthesis: Translation During protein synthesis, the anticodon of a tRNA molecule base pairs with the appropriate mRNA codon.

  20. Protein Synthesis: Translation Ribosome: Protein synthesis starts when the two rRNAsubunitsbind to mRNA. The initiator codon AUG binds to the first anticodon of tRNA, signaling the start of aprotein.

  21. Protein Synthesis: Translation Ribosome: The anticodon of another tRNA binds to the next mRNA codon, bringing the 2nd aminoacid of the protein. As each anticodon & codon bind together a peptide bond forms between the two aminoacids.

  22. Protein Synthesis: Translation The protein chain continues to grow until a stop codon reaches the ribosome, which results in the release of the new protein and mRNA, completing the process of translation.

  23. DNA Transcribed Onto mRNA 1 CODON (mRNA) 1 ANTICODON (tRNA) 1 amino acid

  24. Protein Synthesis: Translation http://www.youtube.com/watch?v=1NkLqjQkGHU&feature=related

  25. Protein Synthesis: Translation 20different amino acidsare used to make proteins. 4 bases in RNA and 3 bases make up one codon: thus 43 (4x4x4)=64 total codons possible.

  26. DNA sense template = CGATGCCTCGAAGCCTCGATC mRNA = GCUACGGAGCUUCGGAGCUAG7 Anticodons of tRNA = CGAUGCCUCGAAGCCUCGAUCAmino Acid =Alanine+Threonine+Glutamine+Leucine+Argnine+Serine+STOP

  27. fMet P A Large subunit E UAC 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Small subunit Translation - Initiation

  28. Polypeptide Arg Met Phe Leu Ser Aminoacyl tRNA Gly P A UCU Ribosome E CCA 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Translation - Elongation

  29. Polypeptide Met Phe Leu Ser Arg Gly P A Ribosome E CCA UCU 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Translation - Elongation Aminoacyl tRNA

  30. H O AMINE ACID Alanine Serine H N C OH H H O O C H N C OH H N C OH R H ANYTHING C C H H Amino Acid H H C C H H HO H H2O H H O O H N C N C OH C C H H H H C C H H HO H Protein Synthesis

  31. Polypeptide Met Phe Leu Ser Arg Gly P A Ribosome E CCA UCU 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Translation - Elongation

  32. Polypeptide Ala Met Phe Leu Ser Arg Aminoacyl tRNA Gly P A CGA Ribosome E CCA UCU 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Translation - Elongation

  33. Polypeptide Met Phe Leu Ser Arg Ala Gly P A Ribosome E CCA CGA UCU 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Translation - Elongation http://highered.mcgraw-hill.com/sites/0072943696/student_view0/chapter3/animation__protein_synthesis__quiz_3_.html http://www.youtube.com/watch?v=nl8pSlonmA0&feature=related

  34. Mutation • A change in the nitrogenous base sequence of DNA; that change can cause a change in the product coded for by the mutated gene. • Neutral • Hazardous • Beneficial

  35. Mutations What happens when you get insertions or deletions of bases in the DNA sequence? Usually you end up with a mess. THE BIG FAT CAT ATE THE RAT AND GOT ILL Deletion of one base THE IGF ATC ATA TET HER ATA NDG OTI LL And its all pops and buzzes!!

  36. Base Substitution - One base pair in DNA is replaced with a different base pair (point mutation) • Deletion - A piece of DNA breaks off and is lost • Duplication and Translocation - A piece of DNA breaks off and is incorporated into another strand of DNA • Frameshift - Deletion or Addition results in a shift in the DNA frame • Silent mutation - codon is changed, but still codes for the same amino acid: serine codons – TCT, TCG, TCA, and TCC

More Related