Introduction The Central Dogma of Molecular Biology

1. DNA Transcription Ribosome mRNA Translation Polypeptide (protein) IntroductionThe Central Dogma of Molecular Biology Cell

2. Protein Synthesis Flow of Information: DNA RNA Proteins Transcription Translation Transcription is the process by which a molecule of DNA is copied into a complementary strand of RNA. This is called messenger RNA (mRNA) because it acts as a messenger between DNA and the ribosomes where protein synthesis is carried out.

3. Protein Synthesis Transcription Transcription process RNA polymerase (an enzyme) attaches to DNA at a special sequence that serves as a“start signal”. The DNA strands are separated and one strandserves as a template. The RNA bases attach to the complementary DNA template, thus synthesizing mRNA.

4. Protein Synthesis: Transcription Transcription process continued The RNA polymerase recognizes a termination site on the DNA molecule and releases the new mRNA molecule. (mRNA leaves the nucleus and travels to the ribosome in the cytoplasm.)

5. Protein Synthesis: Transcription

6. Cytoplasm Nuclear pores AAAAAA AAAAAA DNA Transcription RNA RNA Processing G G mRNA Export Nucleus Eukaryotic Transcription

7. Protein Synthesis: Translation Translationis the process of decoding a mRNA molecule into a polypeptide chain orprotein. Each combination of 3 nucleotides on mRNA is called a codon or three-letter code word. Each codon specifies a particular amino acid that is to be placed in the polypeptide chain (protein).

8. Protein Synthesis: Translation

9. OH NH2 P HO O Adenine N N O N N CH2 O B A S E S H O O Guanine P HO O N NH O SUGAR-PHOSPHATE BACKBONE N NH2 N CH2 O Arginine H O NH2 Adenine P HO O N N O N N CH2 O OH H A Codon

10. Protein Synthesis: Translation A three-letter code is used because there are 20 different amino acids that are used to make proteins. If a two-letter code were used there would not be enough codons to select all 20 amino acids. That is, there are 4 bases in RNA, so 42 (4x 4)=16; where as 43 (4x4x4)=64.

11. Protein Synthesis: Translation

12. Protein Synthesis: Translation Therefore, there is a total of 64 codons with mRNA, 61specify a particular amino acid. This means there are more than one codon for each of the 20 amino acids. The remaining three codons (UAA, UAG, & UGA) are stop codons, which signify the end of a polypeptide chain (protein). Besides selecting the amino acid methionine, the codon AUG also serves as the “initiator” codon, which starts the synthesis of a protein

13. Protein Synthesis: Translation

14. Protein Synthesis: Translation Transfer RNA (tRNA) Each tRNA molecule has 2 important sites of attachment. One site, called the anticodon, binds to the codon on the mRNA molecule. The other site attaches to a particular aminoacid. During protein synthesis, the anticodon of a tRNA molecule base pairs with the appropriate mRNA codon.

15. Protein Synthesis: Translation

16. Methionine A C C 73 1 72 2 71 3 70 4 69 5 68 6 67 59 7 66 Py A* U* 65 64 63 62 C 16 Pu 17 9 A Pu 17:1 13 12 Py 10 49 50 51 52 G C T y G* Py 22 23 Pu 25 47:16 G A 26 47:15 20 20:2 20:1 27 1 43 44 28 42 45 46 29 41 47 30 40 47:1 31 39 Py* 38 U Pu* U 34 36 C 35 A Anticodon Met-tRNA

17. Protein Synthesis: Translation Ribosome: Are made up of 2 subunits, a large one and a smaller one, each subunit contains ribosomalRNA (rRNA) & proteins. Protein synthesis starts when the two subunitsbind to mRNA. The initiator codon AUG binds to the first anticodon of tRNA, signaling the start of aprotein.

18. Protein Synthesis: Translation Ribosome: The anticodon of another tRNA binds to the next mRNA codon, bringing the 2nd aminoacid to be placed in the protein. As each anticodon & codon bind together a peptide bond forms between the two aminoacids.

19. Protein Synthesis: Translation Ribosome: The protein chain continues to grow until a stop codon reaches the ribosome, which results in the release of the new protein and mRNA, completing the process of translation.

20. Protein Synthesis: Translation

21. fMet P A Large subunit E UAC 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Small subunit Translation - Initiation

22. Polypeptide Arg Met Phe Leu Ser Aminoacyl tRNA Gly P A UCU Ribosome E CCA 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Translation - Elongation

23. Polypeptide Met Phe Leu Ser Arg Gly P A Ribosome E CCA UCU 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Translation - Elongation Aminoacyl tRNA

24. H O AMINE ACID Alanine Serine H N C OH H H O O C H N C OH H N C OH R H ANYTHING C C H H Amino Acid H H C C H H HO H H2O H H O O H N C N C OH C C H H H H C C H H HO H Protein Synthesis

25. Polypeptide Met Phe Leu Ser Arg Gly P A Ribosome E CCA UCU 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Translation - Elongation

26. Polypeptide Ala Met Phe Leu Ser Arg Aminoacyl tRNA Gly P A CGA Ribosome E CCA UCU 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Translation - Elongation

27. Polypeptide Met Phe Leu Ser Arg Ala Gly P A Ribosome E CCA UCU CGA 5’ GAG...CU-AUG--UUC--CUU--AGU--GGU--AGA--GCU--GUA--UGA-AT GCA...TAAAAAA 3’ mRNA Translation - Elongation

28. 5’ 3’ 3’ 5’ RNA Pol. Ribosome mRNA Ribosome 5’ Transcription And Translation In Prokaryotes

29. ACGATACCCTGACGAGCGTTAGCTATCG UGC GGG ACUG UAU

31. Transcription Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein Transcription vs. Translation Review