1 / 13

Huntingtons Disease

Huntingtons Disease. Clinical Features. Huntington’s disease is a rapidly progressive neurodegenerative disease that leads to dementia. Typically presents with alterations in mood as well as a change in character, defects in memory and attention.

davalos
Download Presentation

Huntingtons Disease

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Huntingtons Disease

  2. Clinical Features • Huntington’s disease is a rapidly progressive neurodegenerative disease that leads to dementia. • Typically presents with alterations in mood as well as a change in character, defects in memory and attention. • Progresses to a movement disorder consisting of involuntary, rapid motions. • Usually not recognized until the patient is in their early 30’s.

  3. Genotype/Phenotype • Huntington’s is autosomal dominant. • This means that anyone with ONE abnormal copy of the gene will clinically have the disease. • There are no carriers for Huntington’s. • A parent with Huntington’s will have a 50% chance of passing it on to their child.

  4. Statistics: • About 30,000 Americans have HD • 150,000 more are at risk of inheriting the disease from a parent. • There is a 50% chance that a child whose parent has Huntington's will have the disease.

  5. Genomic Information • The HD gene is located on chromosome 4, in the p-arm (4p16.3) • It is a very large gene, consisting of 169,280 base pairs. • Contains 67 exons, which are spliced together in the mRNA template.

  6. mRNA information • mRNA is 13,482 base pairs long • Coding region of mRNA: 146…9580 • Would normally code for 3144 amino acids (very large protein!) • Protein product of this gene is called Huntingtin (with an “i”)

  7. Where errors occur… • The repeat region of CAG tri-nucleotide sequence from 197…265 is called the polyglutamine repeat. This sequence codes for 23 of the amino acid glutamine. 181 gtccctcaag tccttccagcagcagcagca gcagcagcag cagcagcagc agcagcagca 241gcagcagcagcagcagcagcagcagccgcc accgccgccg ccgccgccgc cgcctcctca 301 gcttcctcag ccgccgccgc aggcacagcc gctgctgcct cagccgcagc cgcccccgcc 197 265

  8. Protein Information • There are 23 Q’s (glutamine) in a repeating sequence in the normal protein. This is referred to as the 23Q repeat. MATLEKLMKAFESLKSFQQQQQQQQQQQQQQQQQQQQQQQPPP • The 23Q’s in a normal Huntingtin protein are located as amino acids 18…40. 18 40

  9. Pathological Protein Changes • Expansion of this repeat region is what causes Huntington’s disease. It translates to an unstable polyglutamine repeat in the protein product. Repeats in excess of 40 are considered to be pathological. • The expanded ployglutamine region of the pathological form of the protein causes impairment of the ubiquitin-proteasome system. • This means that the dysfunctional protein is not removed and destroyed as it should be.

  10. Pathology • The exact function of the normal Huntingtin protein is unknown. • However, the accumulation of the abnormal protein is believed to be what causes neurological changes. • The excess of the mutated protein interferes with neurotransmitters.

  11. Ubiquitin-conjugating enzyme E2-25 kDa • Also called “Huntington interacting protein 2” • There are many ubiquitin-conjugating enzymes that attach a ubiquitin molecule to a specific protein. • This specific one attaches ubiquitin to huntingtin. • This enzyme is directly related to the mutation because it is not able to perform it’s function when the HD protein has mutations in the 23Q region.

  12. Different view with PDB viewer It is made up of two identical subunits, A and B, and has a conserved domain (blue.) This domain is found in many enzymes and proteins that bind to ubiquitin.

  13. References 1: Huntington disease Genes and Disease -> The Nervous System 2: Autosomal dominant disorders. An Introduction to Genetic Analysis -> 2 . Patterns of Inheritance -> Human genetics 3:Huntington’s Disease -> Neuroscience -> III. Movement and Its Central Control -> 18. Modulation of Movement by the Basal Ganglia -> Projections to the Basal Ganglia 4: Protein Data Bank – PDB ID #1YLA 5: National Center for Biotechnology Information – Entrez Gene http://www.ncbi.nlm.nih.gov/

More Related