Using DNA Microarrays from Multiple Species: Comparisons for Teaching Effectiveness

1. Using DNA Microarrays from Multiple Species:  Comparisons for Teaching Effectiveness Todd T. Eckdahl Biology Department Missouri Western State College

2. Overview • Background • Courses using microarray technology • Species studied • Implementation • Results • Planned research projects

3. Missouri Western State College • Saint Joseph, Missouri • State-supported PUI • ~5200 students • 200 faculty • Biology Department • ~340 majors • 10 faculty • No graduate degree programs • New major in Biochemistry and Molecular Biology

4. Courses Using Microarray Technology • BIO 431 Molecular Biology • 4 credit course • 3 hours lecture, 3 hours lab • Student majors • BMB, Biology with Health Sciences emphasis • BIO 313 Topics in Molecular Genetics • 1 credit course • 3 hours lab • Student majors • BMB, Biology-Health Sciences, Teaching

5. Functional Genomics Technology • Microarrays • cDNAs printed • eg. Stanford yeast chips, UW E. coli chips • 80-mer oligos printed • eg. ISB yeast chips • Labeling options • Indirect labeling • eg. Genisphere dendrimers • Direct incorporation • eg. Ulysis alexafluore labeling

6. Conducting Microarray Experiments in a Course • Emphasize the “Big Picture” • Genomics, functional genomics, proteomics • Shift to data-rich science • Primary Literature • Brainstorming for ideas • Scheduling • Data Analysis • Presentations

7. Ideas for Yeast Experiments • Glucose vs. Galactose vs. Fructose vs. Maltose • Anaerobic vs. aerobic • Induction of sporulation • Heat Shock v. Cold Shock • Drug treatment

8. Minor Groove Binding Drugs • Anti-tumor properties • Conformational change in the 3D structure of DNA • Prior Knowledge of MGBD/DNA interaction • As models for minor groove binding proteins DAPI

9. Yeast Culture • ODat 660 nm to measure turbidity • Grown through log phase • 4 hours of exposure to 10 uM DAPI • Control culture without DAPI

10. Isolation of RNA • Sterile, RNase- free equipment and workspace • Harvesting of yeast • Production of spheroblasts • Isolation of RNA via RNA spin column • Elution of RNA • Quantify RNA with A260 / A280 • Run RNA on denaturing agarose

11. Preparation of labeled cDNA and hybridization • Reverse transcription of RNA • capture sequence incorporated • Label preparation • addition of Cy3 and Cy5 dendrimer • addition of capturing reagents • Add probe to slide, cover and incubate at 55 C for 1-3 days

12. Experimental Summary Yeast in log phase untreated 10 uM DAPI Total RNA Total RNA Reverse Txn cDNA cDNA Red fluorophore Green fluorophore microarray hybridization

13. Data Acquisition • Post-hybe wash, dry slide • Ship for scanning • Receive data • Scanalyze • Submit to SMD

15. Microarray Controls • Empty or 3X SSC • Duplicate genes • Duplicate experiments • Cy3 and Cy5 dyes • Poly A • Genomic, Intron, tRNA

16. Example of induced gene YBR012W-B, TyB Gag-Pol protein TGAGAAGCTGTCATCGAAGTTAGAGGAAGCTGAAGTGCAAGGATTGATAA TGTAATAGGATAATGAAACATATAAAACGGAATGAGGAATAATCGCAATA TTAGTATGTAGAAATATAGATTCCATTTTGAGGATTCCTATATCCTCGAG GAGAACTTCTAGTATATTCTGTATACCTAATATTATAGCCTTTATCAACA ATG

17. Example of repressed gene YHR055C, copper-binding metallothionein TTCCGCTGAACCGTTCCAGCAAAAAAGACTACCAACGCAATATGGATTGT CAGAATCATATAAAAGAGAAGCAAATAACTCCTTGTCTTGTATCAATTGC ATTATAATATCTTCTTGTTAGTGCAATATCATATAGAAGTCATCGAAATA GATATTAAGAAAAACAAACTGTACAATCAATCAATCAATCATCACATAAA ATG

18. Analyses at Stanford Microarray Database • Single spot or sequence • Data filtering • signal strength • R/G or G/R ratio • Linear regression comparison • Prepare data for clustering

19. Databases linked to SMD • SGD - Saccharomyces genome database • Genbank • YPD - yeast protein database • Swissprot protein database

20. Ideas for E. coli Experiments • Metabolic shift • Osmotic stress • Growth curve effects • Heat Shock v. Cold Shock • Drug treatment • Effects of gene deletion

21. BIO 313 Experiment • E coli chips • M1655 sequenced strain • cDNA spotted • Putative transcriptional regulators • nusA deletion strain • yhbM deletion strain • Two channel hybridizations • Compare labeled RNA from wt versus deletion

23. E. coli culture • Overnight culture • Grown at 37°C to log phase • OD at 600 nm to measure turbidity

24. RNA Isolation • Sterile, RNase-free equipment and work area • Total RNA SafeKit • Total RNA Safe protocol used • Lysis of E. coli done with mixture of TE and lysozyme

25. RNA Isolates • Measure A260 / A280 • Check on denaturing agarose gel

26. Labeling • Labeling of isolated RNA done by use of ULYSIS Nucleic Acid Direct Labeling Kit • ULYSIS protocol followed • Fluorescent Dyes: Alexa Fluor 546 (green) and Alexa Fluor 660 (red)

27. Hybridization • Microarray prehybridized • Labeled RNA mixed together in hybridization buffer and added to slide • Hyb at 55 C in dry incubator overnight • Post-hyb washes

28. Microarray Controls • Empty or 3X SSC • Duplicate genes • Duplicate experiments • Cy3 and Cy5 dyes • Genomic

29. Examples of Results asrflhCemrY

30. Examples • Induced • Asr, G1787881 • acid shock protein • Repressed • flhC, G1788201 • regulator of flagellar biosynthesis acting on class 2 operons • Non-responsive • emrY, G1788710 • multidrug resistance protein Y • putative transport

31. Example of induced gene Asr, G1787881 gatca agactactattattggtagctaaatttcccttaagtcac aatacgttattatcaacgctgtaatttattcagcgtttg tacatatcgttacacgctgaaaccaaccactcacggaag tctgccattcccagggatatagttatttcaacggccccg cagtggggttaaatgaaaaaacaaattgagggtatgaca 1 - atg aaa aaa gta tta gct ctg gtt gtt gcc 31 - gct gct atg ggt ctg tct tct gcc gcc ttt 61 - gct gca gag act acg acc aca cct gct ccg 91 - act gcg acg acc acc aaa gca gcg ccg gcg

32. Example of repressed gene flhC, G1788201 ccgca aatggttaagctggcagaaaccaatcaactggtttgtca cttccgttttgacagccaccagacgattactcagttgac gcaagattcccgcgttgacgatctccagcaaattcatac cggcatcatgctctcaacacgcttgctgaatgatgttaa tcagcctgaagaagcgctgcgcaagaaaagggcctgatc 1 - atg agt gaa aaa agc att gtt cag gaa gcg 31 - cgg gat att cag ctg gca atg gaa ttg atc 61 - acc ctg ggc gct cgt ttg cag atg ctg gaa 91 - agc gaa aca cag tta agt cgc gga cgc ctg

33. Example of non-responsive gene emrY, G1788710 gaact catggaacaccccttgcgtattggtttatcgatgacagc aactattgatacgaagaacgaagacattgccgagatgcc tgagctggcttcaaccgtgacctccatgccggcttatac cagtaaggctttagttatcgataccagtccgatagaaaa agaaattagcaacattatttcgcataatggacaacttta 1 - atg gca atc act aaa tca act ccg gca cca 31 - tta acc ggt ggg acg tta tgg tgc gtc act 61 - att gca ttg tca tta gcg aca ttt atg caa 91 - atg ttg gat tcc act att tct aac gtc gca

34. Microarrays in Courses:Lessons Learned • Advance planning essential • Controls for critical steps • Reliability and Reproducibility • Do Controls Make Sense? • Do Results Make Sense? • Potential for large amounts of data means extensive analysis time needed

35. Ongoing and Planned Research Projects • Measure Effects of Minor Groove Binding Drugs on Gene Expression in Yeast • Measure Effects of Minor Groove Binding Drugs on Gene Expression in Human Tumor Cells in Culture

36. Big Ideas • Sequence and structural requirements for MGBD binding • A+T rich sequences • DNA bending • Determination of optimal binding sites • Effects of MGBDs on gene expression • Preliminary data using RT-PCR • Global patterns of gene expression • Complementary in vitro and in vivo approaches

37. Acknowledgements • Genome Consortium for Active Teaching • Malcolm Campbell, Davidson College • NSF DBI 0099720 MUE grant • Dr. Barbara Dunn, Stanford University • Dr. Fred Blattner lab, UW-Madison • Dr. Bob Getts, Genisphere, Inc. • Missouri Western Students