1 / 7

DNA Fingerprinting

DNA Fingerprinting. Enzymes. Enzymes are proteins that are used for a specific job in a cell. The enzymes used to make a DNA Fingerprint cut DNA bases in a specific spot.

gigi
Download Presentation

DNA Fingerprinting

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA Fingerprinting

  2. Enzymes • Enzymes are proteins that are used for a specific job in a cell. • The enzymes used to make a DNA Fingerprint cut DNA bases in a specific spot. • The DNA is then run through a magnetic set-up called gel electrophoresis which separates and graphs the DNA by how long the segments are.

  3. For the crime: • We will use the enzymes EcoR1 and HindIII • One of you choose EcoR1 and one choose HindIII…write the choice at the top of your paper • EcoR1: will break the DNA between the bases G/AATTC • Hind III: Will break the DNA between the bases A/AGCTT

  4. Now that you have made the breaks, count the # of bases between each one. • For example: • TTACGTAGAATTCCCGAATTCATCGG

  5. We will graph each of the pieces of Dna: • A line represents each segment of DNA

  6. Next you need to combine the breaks of EcoR1 and HindIII to break the DNA into smaller yet fragments. • On the new paper, recopy your breaks from EcoR1… • Pass to your partner for HindIII • This will make smaller fragments.

  7. Graph the combined breaks on the appropriate graph. • Whichever suspects matches these breaks is the criminal. • Criminal investigators will get the picture (similar to the graphs you just made) to determine who committed the crime.

More Related