RNA and Protein Synthesis

1. RNA and Protein Synthesis Chapter 12, section 3

2. The Structure of RNA • RNA, like DNA, is made up of nucleotides • However, there are 3 differences between DNA and RNA: • RNA has ribose instead of deoxyribose • RNA has uracil instead of thymine • RNA is single-stranded instead of double-stranded

3. 3 Types of RNA • Messenger RNA (mRNA) – carries the message from the DNA to the ribosomes • Ribosomal RNA (rRNA) – make up part of the structure of a ribosome • Transfer RNA (tRNA) – transfers amino acids to the ribosomes

4. Transcription • Making RNA from DNA (in the nucleus) • RNA polymerase binds to a special region of DNA called a promoter • The RNA polymerase then separates the DNA strands and uses one of the strands as a template • A will now pair with U, T still pairs with A • C and G still pair with each other

5. Transcription

6. Practice Transcription… • DNA – AGCTCCGATGCATACTTGCCA • RNA – UCGAGGCUACGUAUGAACGGU • DNA – GCCAGTGCTTACGAACTGAGT • RNA - CGGUCACGAAUGCUUGACUCA

7. RNA Editing • RNA requires a little editing before it is ready to go to the ribosome to make proteins • Introns – sections of RNA that do not code for a protein (“in the way”) • Cut out • Exons – sections of RNA that do code for a protein (“expressed”) • spliced back together

8. RNA Editing

9. The Genetic Code • Proteins are made of amino acids • There are 20 different amino acids • A codon is a 3 base sequence that codes for a specific amino acid • There are 64 possible codons

10. The Genetic Code

11. The Genetic Code • RNA sequence: • UCGCACGGU • Separate into codons: • UCG-CAC-GGU • Identify the amino acids: • Serine-Histidine-Glycine

12. Translation • Making the proteins from the mRNA (“translating the code”) • Occurs on the ribosomes

13. Translation • mRNA must be transcribed from the DNA in the nucleus and released into the cytoplasm • The mRNA attaches to the ribosome • The tRNA brings the proper amino acid to the ribosome • Anticodon – sequence of bases on the tRNA that pair with the mRNA

14. Translation • The amino acids form a peptide bond to hold them together • The next amino acid is brought in and is attached • This continues until the ribosome reaches a stop codon • The completed protein is then released

15. Translation

16. Mutations • Changes in the DNA sequence that affect genetic information • Gene mutations – result from changes in a single gene • Chromosomal mutations – involve changes in whole chromosomes

17. Gene Mutations • Point mutations – a mutation that occurs at a single point (only 1 nucleotide is changed) • Substitution – a single nucleotide is substituted for another one (A instead of G) • Insertion – a nucleotide is added • Deletion – a nucleotide is removed

18. Gene Mutations • Insertions and deletions cause frameshift mutations because they shift the “reading frame” of the genetic message.

19. Chromosomal Mutations • Deletion – a section of a chromosome is deleted • Duplication – a section of a chromosome is copied and inserted • Inversion – a section of a chromosome is moved from one spot to another • Translocation – a piece of a chromosome is moved from one chromosome to another

20. Chromosomal Mutations