International Tomato Genome Sequencing Project

1. International Tomato Genome Sequencing Project Country USA Korea China UK India NL France Japan Spain USA USA Italy 1 2 3 4 5 6 7 8 9 10 11 12 Chromosome Mb 24 26 26 19 12 20 27 17 16 10 13 11 T=220 To sequence BACs 246 268 274 193 120 213 277 175 164 108 135 113 T=2285 0 µm 53.8 Mb 64.7 Mb 64.7 Mb 80.0 Mb 82.1 Mb 80.3 Mb 81.8 Mb 76.4 Mb 83.6 Mb 85.6 Mb 88.5 Mb Euchromatin & 108.0 Mb Heterochromatin 70 µm

2. Indian Initiative on Tomato Genome Sequencing Telomeric Region University of Delhi South Campus Euchromatic Region UDSC & NCPGR Akhilesh K. Tyagi J. P. Khurana P. Khurana Arun Sharma (0-60 cM) Heterochromatic Region National Research Centre for Plant Biotechnology Centromeric Region Nagendra K. Singh T. Mohapatra T. R. Sharma K. Gaikwad Heterochromatic Region NRCPB (69-119 cM) National Centre for Plant Genome Research Euchromatic Region Debasis Chattopadhyay Sabhyata Bhatia Telomeric Region

3. The path for genomic sequencing Single streak of BAC clones from seed BAC library DNA extraction DNA fingerprinting (HindIII-digested) for BAC stock purity PCR with genetic marker for re-confirmation IL-mapping for chromosome 5-specificity CHEF-analysis for size estimation presence of SNP/indels Polymorphism in PCR (digested) products Haplotype 1 TACGTG...TTAT 2 CGAACAI/DGACA 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, seed BAC 2: L. pennellii, IL 5-1 Shotgun cloning and sequencing Assembly of sequence BAC annotation Selection of extension BAC Searching for STCs (Sequence Tag Connector) SGN end-sequence database Overgo hybridization

4. Confirmation of marker CT101 and its assigned seed BAC position on chromosome 5 Marker:CT101 Seed BAC:LE_HBa0191B01 Haplotype 1: -ACCCCTCAATATTTCGCTCCAA Haplotype 2:TGTATACTTGCGCCAGTTCAGGG Haplotype 1: M82, IL 5-2, IL 5-3, IL 5-4, IL 5-5, LE_HBa0191B01 Haplotype 2: L. pennellii, IL 5-1 (M82) L. pennellii IL 5-1 IL 5-2 IL 5-3 IL 5-4 IL 5-5 L. esculentum

5. Confirmation of markers and their assigned seed BAC positions on chromosome 5

6. Reallocation of marker T0876 and its associated BAC positions on chromosome 7

7. BACs mapped on chromosome 7 Chromosome 7 SP6 SP6 SP6 SP6 T7 HBa0144B20 HBa0123J08 HBa0064M20 HBa0102G23 HBa0188L22 SP6 Primer pair 1 ~1.4 kb overlap SP6 Primer pair 2 ~3.5 kb overlap T7 T7 T7 T7 MboI0077G20 (92 kb) SP6 T1401 (COS) 95 cM Primer pair 1 12955 bp overlap (100%) CT223 (RFLP) T7 HBa0179K09 (108 kb) T7 Primer pair 1 9002 bp overlap (100%) Clones sequenced to Phase III level T7 Clones sequenced to Phase II level MboI0032F07 (~140 kb) SP6 Extension clones verified T7 Red bars indicate the PCR positive nature of BAC clones using respective primer pairs ~19 kb overlap Primer pair 2 ~15.5 kb overlap Primer pair 1 SP6 Dotted line indicates the expected overlap MboI0052O23 MboI0083J01 Green line shows the presence of mapped markers on the BAC clones SP6 T7

8. L. esculentum L. pennellii IL 5-1 IL 5-2 (M82) L. pennellii IL 5-1 IL 5-2 SNP-based analyses for confirmation of introgressed fragment of L. pennellii in IL5-2

9. L. esculentum L. pennellii IL-5-2 Confirmation of introgressed fragment of L. pennellii in IL5-2 (M82) L. pennellii IL 5-1 IL 5-2 Marker T0619 (59cM)

10. New seed BACs in IL 5-2 region Seed BACs C2_At2g01110 37 cM 43.7 cM CT227 46 cM T1790 Seed BACs Seed BACs • Seed BACs PCR positive using genetic markers • Localization on Chromosome 5 yet to be ascertained

11. The selected seed BACs and their extension BACs Status Clones selected Marker cM Phase I SL_MboI0050C14 Telomeric Region CT101 0 Phase III LE_HBa0191B01 0 LE_HBa0106O06 Phase III C2-At1g60440 Phase III T1252 3 LE_HBa0051A13 Phase III SL_MboI0005B15 Library SL_EcoRII0101I15 Euchromatic Region Short Arm UDSC & NCPGR Library SL_MboI0111D17 T1632 4 LE_HBa0261K11 Phase III C2-At1g60200 7 Phase II SL_EcoRI0086I08 Phase III 10 LE_HBa0042B19 cLET-8-B23 Phase I LE_HBa0189E17 11 T0564 LE_HBa0179E24 Phase II cLED-8-G3 15.5 Phase III SL_MboI0037H06 Heterochromatic Region Phase I SL_MboI0095J08 Library LE_HBa0074A13 16 Phase III LE_HBa0058L13 T1592 LE_HBa0195M17 Sequencing Centromeric Region Library LE_HBa0051A18 LE_HBa0027B05 Phase II BS4 21 SL_EcoRI0053P22 Phase I Phase I LE_HBa0169M21 T1360 73 Heterochromatic Region Phase I LE_HBa0334K22 cLEX-13-G5 79 Library LE_HBa0138J03 T1746 84 Phase II LE_HBa0166A02 T1777 105 Phase II LE_HBa0168B11 T1541 107 Long Arm Phase II LE_HBa0040C21 Library LE_HBa0025A19 Phase II LE_HBa0131D04 T1584 108 NRCPB Library LE_HBa0100I06 TG69 111 Phase II LE_HBa0006N20 Euchromatic Region Phase II LE_HBa0108A18 Library LE_HBa0019C24 Library LE_HBa0141A12 CT130 115 Phase II LE_HBa0239D11 Library LE_HBa0013H09 LE_HBa0251J13 TG185 Phase II 119 LE_HBa0028M20 Library 119 Telomeric Region Phase II LE_HBa0245E05 TG597 119 LE_HBa0076P16 Library CT138

12. Physical map: issues Chromosome BAC clones 0 0 3 3 4 7 7

13. Important genes present on some BAC clones

14. Summary 1. All BAC clones are being mapped on chromosome 5 by using chromosome 5-specific introgression lines 2. Twenty three seed BAC clones using 21 markers have been confirmed 3. Sixteen extension BAC clones from 6 nucleation points have been confirmed 4. Finally, 39 BAC clones, covering approximately ~3.0 Mb region, have been mapped 5. Sequencing status of 26 BAC clones * Three finished BAC clones submitted to SGN/NCBI * Five BAC clones in phase III (quality improvement) * Twelve BAC clones in phase II (11 submitted to NCBI) * Six BAC clones in phase I 6. Two BAC clones from chromosome 7 have also been completely sequenced and submitted to SGN and NCBI 7. Three new nucleation points confirmed by presence of genetic marker, to be confirmed on chromosome 5