1 / 67

The Blueprint of Life, From DNA to Protein

The Blueprint of Life, From DNA to Protein. Chapter 7. Preview. How does the genetic information pass on to the next generation? How is the information stored in DNA being used to make protein? How are the protein expression regulated?. The Blueprint of Life.

josephhoward
Download Presentation

The Blueprint of Life, From DNA to Protein

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. The Blueprint of Life,From DNA to Protein Chapter 7

  2. Preview • How does the genetic information pass on to the next generation? • How is the information stored in DNA being used to make protein? • How are the protein expression regulated?

  3. The Blueprint of Life • Characteristics of each cell dictated by information contained on DNA • DNA holds master blueprint • All cell structures and processes directed by DNA

  4. Review of DNA basics • Composed of deoxyribonucleotides • Covalently bonded in chains 5’ end (phosphate) 3’ end (hydroxyl) • Double-stranded • Strands are complementary • Base-pairing rules: • A-T • G-C • Strands are anti-parallel Two H bonds Three H bonds • Double helix • Sugar-phosphate backbone

  5. 3’ 5’ N N N N N N N N N N N N N N N N N N N N 5’ 3’ A A A A A A T T T T T T question If there are 400 cytosines in a DNA molecule that has 1000 base-pairs, how many adenines does the molecule have? C C C C G G G G

  6. Figure 7.1

  7. DNA Replication

  8. Orig. New New Orig. DNA Replication • Semi-conservative

  9. DNA Replication • Semi-conservative • Bi-directional • Second round of replication can start before first is complete • Synthesis is 5’  3’ (note: polymerase reads template 3’  5’) • DNA polymerase “reads” template, adds proper nucleotide to the 3’ end of the new chain • DNA polymerases generally corrects errors during replication (“proofreading”) • Error rate = 1/billion nucleotides • DNA polymerases require a primer (they can only add nucleotides onto an existing chain)

  10. question If a primer were available that bound to the center of the template molecule in the diagram below, which way would DNA polymerase move during DNA synthesis?

  11. 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ 3’ 5’ question 5’

  12. 3’ 5’ question 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ 5’

  13. 3’ 5’ question 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ 5’

  14. 3’ 5’ question 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ 5’

  15. 3’ 5’ question 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ 5’

  16. 3’ 5’ question 3’ 5’ A G T C T G C C T A T C G T G A C T A T C A G A C G G A T A G C A C T G A T 5’ 5’ 3’ and so on… 5’

  17. 5’ 3’ 3’ 5’ *Depicts only a small segment of the circular chromosome DNA Replication Replication is initiated at a single distinct region (origin of replication = ori)

  18. 5’ 5’ DNA Replication Replication is initiated at a single distinct region (origin of replication = ori) 5’ 3’ 3’ 5’ A short stretch of RNA (complementary to DNA) is synthesized

  19. DNA Replication Replication is initiated at a single distinct region (origin of replication = ori) 5’ 5’ 3’ 3’ 5’ 5’

  20. DNA Replication Replication is initiated at a single distinct region (origin of replication = ori) 5’ 5’ 3’ 3’ 5’ 5’ • The replication fork (details are shown in Figure 7.6, which is optional) • Leading strand - continuous synthesis • Lagging strand - discontinuous synthesis (Okazaki fragments) • DNA ligase

  21. DNA Replication • Semi-conservative • Bi-directional • Second round of replication can start before first is complete

  22. DNA Replication

  23. Gene expression

  24. DNA to Proteins - General Principles -- .. -.-. .-. --- -... .. --- .-.. --- --. -.-- M I C R O B I O L O G Y • Morse code: Distinct series of dots and dashes encode the 26 letters of the alphabet • Letters strung together make words  sentences  stories ATGCCCGTAGATGGCCCTGAGCGACCGGACCCTGATGCC met pro val asp gly pro glu arg pro asp pro asp ala DNA: Distinct series (triplets) of the four nucleotides encode the 20 amino acids • Amino acids strung together make proteins (structural and functional) cells  organisms

  25. Transcription Translation Protein molecules RNA transcripts: Protein D D D Protein D D D D D D Protein D Protein D D D D D Protein D D D D D D D D Protein D Protein D D D D D D Protein D D D Protein D D D D D D D D D Protein D Gene Expression - Overview Coded by DNA: Protein A Protein B Protein C Protein D Protein E Protein F Protein G Protein H Protein I Gene: functional unit of DNA that contains information to produce a specific product

  26. Transcription Translation Gene Expression - Overview RNA transcripts: Protein molecules Coded by DNA: Protein A Protein B Protein C Protein D Protein E Protein F Protein G Protein H Protein I Three functional types of RNA: • Messenger (mRNA) • Ribosomal RNA (rRNA) • Transfer RNA (tRNA) rRNA tRNA

  27. OH Review of RNA basics Characteristics of RNA • Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine

  28. Characteristics of RNA Characteristics of RNA • Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine • Single-stranded • Sequence is “identical” to a stretch of one strand of DNA; complementary to the other

  29. RNA Characteristics of RNA • Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine • Single-stranded • Sequence is “identical” to a stretch of one strand of DNA; complementary to the other

  30. RNA Characteristics of RNA • Composed of ribonucleotides (ribose not deoxyribose); uracil replaces thymine • Single-stranded • Sequence is “identical” to a stretch of one strand of DNA; complementary to the other Template strand Note: always read (and write) a DNA (or RNA) sequence in the 5’ to 3’ direction, or specify otherwise

  31. Bacterial Gene Expression -Transcription Transcription initiates at a promoter (sequence “theme” recognized by RNA polymerase) Transcription stops at a terminator 5’TTGACA3’ 3’AACTGT5’

  32. Bacterial Gene Expression -Transcription Initiation - RNA polymerase binds to promoter (guided by sigma factor) Elongation - RNA polymerase synthesizes RNA in 5’  3’ (no primer needed) Termination - Terms to note: Monocistronic Polycistronic (prokaryotes only) Upstream Downstream

  33. 3’T A C T A G A C T C A T A C G C G A5’ Bacterial Gene Expression -Transcription 5’ A T G A T C T G A G T A T G C G C T3’ 3’T A C T A G A C T C A T A C G C G A5’

  34. Bacterial Gene Expression -Transcription 5’ A T G A T C T G A G T A T G C G C T3’ 3’U A C U A G A C U C A U A C G C G U5’ 5’ A U G A U C U G A G U A U G C G C U3’ 3’T A C T A G A C T C A T A C G C G A5’ 5’-----------3’ 3’ACAGTT5’ 5’TTGACA3’ 3’ -----------5’

  35. Prokaryotic Gene Expression -Transcription

  36. Prokaryotic Gene Expression -Transcription

  37. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC • Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins • Message is read in triplets (codons)

  38. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC • Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins • Message is read in triplets (codons)

  39. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC • Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins • Message is read in triplets (codons) • Genetic code is degenerate But where should the ribosome start “reading”???

  40. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC • Ribosomes “read” mRNA; facilitate conversion of the encoded information into proteins • Message is read in triplets (codons) • Genetic code is degenerate • But where should the ribosome start “reading”??? • Eukaryotes (moncistronic messages only)- translation begins at first AUG • Prokaryotes (monocistronic and polycistronic messages) - translation begins at first AUG after a ribosome-binding site

  41. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC Proper reading frame is critical AUG

  42. Bacterial Gene Expression - Translation AGAAUGCCCAAUGCGUUACGAUGCCC Proper reading frame is critical

  43. Bacterial Gene Expression - Translation tRNAs are the “keys” that decipher the code • Each tRNA carries a specific amino acid • Each tRNA has a specific anticodon, complementary to a codon, that binds mRNA

  44. Bacterial Gene Expression - Translation E P A Initiation 5’ Elongation translocation elongation factors

  45. Bacterial Gene Expression - Translation Termination

  46. Bacterial Gene Expression - Translation

  47. Eukaryotic Gene Expression

  48. Prokaryotic Gene Expression

  49. Eukaryotic Gene Expression

More Related