Topic 7. Lecture 12. Origin of Homo sapiens Prologue: our place among placental mammals

1. Topic 7. Lecture 12. Origin of Homo sapiens Prologue: our place among placental mammals Primates belong to the clade Euarchontoglires, which diverged into Glires (rodents and lagomorphs) and Euarchonta (Scandentia, Dermoptera, and Primates) ~100 - 80 mya. The ancestral lineage of Primates diverged 90 - 65 mya.

2. Extant Scandentia comprise two families of tree shrews (20 species totally). Tree shrews Scandentia: common tree shrew Tupaia glis (left) and the pen-tailed tree shrew Ptilocercus lowii (right).

3. Extant Dermoptera consist of only two species of flying lemurs. Flying lemurs Dermoptera: colugo Galeopterus variegatus (left) and Philippine flying lemur Cynocephalus volans (right).

4. The relationships between major clades of Primates. Strepsirrhini, Haplorrhini, Platyrrhini, and Catarrhini stand for wet-nosed, simple-nosed, broad-nosed, and narrow-nosed primates, respectively. The sister clade of Strepsirrhini (lemurs and allies) is Haplorrhini. The clade comprising Old World monkeys, gibbons, and great apes is Catarrhini. The clade comprising New World monkeys is Platyrrhini. A relatively old age of Primates is reflected in their wide area of endemism.

5. The basal clade of extant primates, Strepsirrihini, comprise ~140 species living in Madagascar, where there are no other native primates, Southeast Asia, and Africa. Strepsirrhini: Mohol bushbaby Galago moholi (left) , Black lemur Eulemur macaco macaco (center), and Golden potto Arctocebus aureus (right).

6. ~130 of species of Platyrrhini inhabit Central and South America. Platyrrhini: Brown spider monkey Ateles hybridus (left), Night monkey Aotus lemurinus zonalis (center), and Capuchin monkey Cebus capucinus (right).

7. ~130 species of Old World monkeys Cercopithecoidea live in Africa and Asia. Cercopithecoideae: Japanese snow monkey Macaca fuscata (left), Gelada Theropithecus gelada (center), Vervet monkey Cercopithecus aethios (right).

8. All ~20 extant species of Hominoidea (gibbons Hylobatidae and Hominidae) lack tails. Over 10 species of Hylobatydae live in rainforests of Asia and Indonesia. Hylobatidae: Lar gibbon Hylobates lar (left), siamang Symphalangus syndactylus (center), hoolock Hoolock hoolock (right).

9. Summary of the fossil record of Primates.

10. The stem-group Plesiadapiformes lived ~65-40 mya in Europe, Asia, North America and Africa. Similarities of Plesiadapiformes and extant Primates include nails, instead of claws, and a number of dental traits. 55 Ma plesiadapiform Carpolestes simpsoni, found in Wyoming. C. simpsoni was a committed arborealist capable of grasping small-diameter supports with both its hands and feet, and might be similar to the common ancestor of extant Primates.

11. The earliest known crown-group Primates, which probably belong to the stem-group of Strepsirrhini, are Adapiformes, who lived 60-20 mya in the same broad area as Plesiadapiformes. Some Adapiformes were quite large and shared a number of similarities with Haplorrhini, apparently due to convergent evolution. Darwinius masillae, a 47 Ma old adapiform, found in Germany.

12. Plausible stem Haplorrhini from a family Eosimiidae appeared in Asia 54 mya and in Africa 45 mya. Haplorrhini are known to became diverse 34 Ma. Sample of North African ~34 Ma late Eocene monkeys from Fayum Quarry, Egypt.

13. Fossils of a stem catarrhine species Aegyptopithecus zeuxis are known from the 29-30 Ma Jebel Qatrani Formation in Egypt. They include a small female cranium which indicates strong sexual dimorphism. A. zeuxis had a brain-to-body mass ratio lower than in living Haplorrhini. Thus, relative brain size of the last common ancestor of crown Haplorrhini was probably strepsirrhine-like or even smaller, and encephalization evolved independently in Platyrrhini and Catarrhini. A female cranium and reconstruction of A. zeuxis.

14. A plausible stem hominoid genus Proconsul lived in African rainforests since 23 Ma and its several species were generalized arboreal quadrupeds. Their brain-to-body mass ratio was slightly above those of extant Cercopithecoidea. Like all extant hominoids, Proconsul species lack tails, which is probably their synapomorphy. The clade of Proconsul may survive until at least 9.5 Ma. Fossils of Proconsul helesoni (left) and Proconsul africanus (middle) and reconstruction of P. africanus (right).

15. There was a substantial diversity of hominoids 17-14 mya: eight large-sized species have been described from fossils found in Africa, Western Asia, and Europe, but their phylogenetic position is not yet clear. Skeleton of an adult male of Nacholapithecus kerioi, large-sized hominoid from 15 Ma Aka Aiteputh Formation in Nachola, Kenya.

16. Extants hominids include 4 genera and 7 species. Phylogeny of hominids. Numbers refer to times of cladogeneses in Ma. Homo-Pongo genetic distance is 0.029; Homo-Gorilla is 0.017; and Homo-Pan is 0.013. Bornean orangutan Pongo pygmaeus, Sumatran orangutan Pongo abelii, Western gorilla Gorilla gorilla, Eastern gorilla Gorilla beringei, Common chimpanzee Pan troglodytes, and Bonobo Pan paniscus.

17. Fossil record of the crown group Hominidae includes Asian genera Sivapithecus and Gigantopithecus from the clade of modern orangutans. Sivapithecus lived between 13 and 8 Ma. Gigantopithecus went extinct 0.3 mya, and G. blacki was the largest ape known, standing up to 3 m and weighting up to 540 kg. Sivapithecus indicus. Teeth of 10 Ma Chororapithecus abyssinicus, a possible member of Gorilla clade. 9.9 Ma Nakalipithecus nakayamai from Nakali, Kenya, a possible stem group African hominid.

18. Human-chimpanzee clade This clade evolved in Africa from the HCLCA 6 - 9 Ma. What can we say about it? Genetically, hominids are so close that we can use parsimony to reconstruct mot of the genome of the HCLCA from (((Homo, Pan), Gorilla), Pongo) phylogeny. acactctaaggaaggttcaGtgggttaggaatttgagactgagatcaatgtgtatcacctgtgtgccagtgaatgctctcctagcgttaaatc-gaatga acactctaaggaaggttcaatgggttaggaatttgagactgagatcaatgtgtatcacctgtgtgccagtgaatgctctcctagcgttaaatcagaatga acactctaaggaaggttcaatgggttaggaatttgagactgagatcaatgtgtatcacctgCgtgccagtgaatgctctcctagcgttaaatcagaatga agaatttagatcctagggagaaaactgtcaaaagtgagactgggcgaggctccacgaagggggaagcatcagctatgggctggccacaggagtagaacac agaatttagatcctagggagaaaactgtcaaaagtgagactgggcgaggctccacgaagggggaagcatcagctatgggctggccacaggagtagaacgc agaatttagatcctagggagaaaactgtcaaaagtgagactgggcgaggctccacgaagggggaagcatcagctatCggctggccacaggagtGgaacac ttagctcagtccccagtgggcaaacacaatggggaccttaaacaggtgctggaggtgtctccctctaggttgagtcagtctgtcaagcccacagcattct ttagcCcagtccccagtgggcaaacacaatggggaccttaaacaggtgctggaggtgtctccctctaggttgagtcagtctgtcaagcccacagcattct ttagctcagtccccagtgggcaaacacaatggggaccttaaacaggtgctgTaggtgtctccctctaggttgagtcagtctgtcaagcccacagcattct A typical human-chimpanzee-orangutang alignment. Changes (2) that occurred, after human-chimpanzee split, in human lineage are in red, changes (1) in chimpanzee lineage are in blue, and changes in orangutan lineage, after (human,chimpanzee)-orangutan split, are in green. If we ignore changes that occur in human and in chimpanzee lineages, we obtain the HCLCA genome. However, this is not enough to recover its phenotype, because we do not know genotype -> phenotype maps. How many changes in the genome would it take to convert a chimpanzee into a passable human? Currently, we have no clue.

19. Applying parsimony to phenotypes is risky, because some traits changed a lot between hominids, so that there is a risk of homoplasy. Comparative neuroanatomy of humans and chimpanzees. It may be safe to assume, from cranial capacities of gorillas (500 cm3), chimpanzees (400 cm3) and humans (1350 cm3), that HCLCA had a relatively small brain, which increased later in the human lineage. However, in other cases parsimony may not work. For example, gorillas and chimpanzees probably acquired knuckle-walking independently, so that HCLCA was bipedal. Also, comparison of modern species tells us nothing about the timing and order of different changes. Thus, data on the last step of human evolution come mostly from fossils.

20. Overview of fossils that certainly or probably belong to the human clade after human-chimpanzee split (hominin clade). Key points: The brain size originally was ~350 cm3, and increased slowly at first reaching only ~450 cm3 by 2.5 mya, after which time it begun to increase rapidly. In contrast, bipedality evolved very early, before 5.0 mya, and 4.0 mya the feet of our ancestors became non-grasping. Teeth and jaws were not large initially, but their size increased 4.4 - 2.5 mya, only to become smaller again later. There is almost no fossil record of Pan clade. Naming 7 genera here is ridiculous.

21. Another useful summary of the hominin fossils.

22. The simplest possible story of hominid clade: Only three generic names will be used for temporal segments of our lineage. The diagram explains the current data with the minimal number of cladogeneses. In addition to our own lienage, there were at least 3 or 4 now-extinct dead-end clades. Without fossils, they would remain unknown forever.

23. Ardipithecus segment of the human lineage The ~7.0 - 4.3 Ma segment of the human lineage will be referred to as genus Ardipithecus ("ardi" = ground or floor in Afar language). The fossil record of this segment until 4.4 Ma is poor. There "species" (just labels, really) are used for these early fossils. 1. Ar. (Sahelanthropus) tchadensis Comparison of craniums of: a, Homo sapiens; b, Pan troglodytes; c, Australopithecus africanus (see below); and d, Ardipithecus tchadensis . ~7 Ma Ar.tchadensis is known from nearly-complete cranium and jaw fragments found Chad. Ar.tchadensis had thick brow ridges and cranial capacity of ~360cm3. Anatomy of the cranium suggest that Ar.tchadensis was likely bipedal and walked upright. It was probably close to the HCLCA, and likely, but not definitely, belonged to the human clade.

24. 2. Ar. (Orrorin) tugenensis ~ 6 Ma Ar. tugenensis is represented by teeth and fragments of leg and arm bones found in Kenya. Its femur (thighbone) provides the first postcranial evidence of bipedality in the human clade, and indicates, together with its primitive teeth, that Ar. tugenensis may belong directly to the ancestral lineage of modern humans. Femora of (A) P. troglodytes, (B) Ar. tugenensis, (C and D) Paranthropus robustus (see below), (E) Australopithecus afarensis (see below), (F) Paranthropus boisei (see below), (G) early Homo, and (H) modern H. sapiens. Ar. tugenensis femur(B) is distinct from those of modern humans (H) and great apes (A) in having a long, anteroposteriorly narrow neck and wide proximal shaft.

25. 3. Ar. kadabba The next fossil from the Ardipithecus segment, Ar. kadabba, is the first of eight kinds of hominin fossils, spanning the time interval from ~6.0 to 0.08 Ma, which were found in the Middle Awash area of the Ethiopian Afar rift. Middle Awash area with three out of many important sited shown. 5.8 Ma Ar. kadabba was found at the Asa Koma; 4.4 Ma Ar. ramidus was found at the Aramis; and 4.2 - 4.1 Ma Australopithecus anamensis was found at Asa Issie. Other fossils found there are 3.4 Ma Au. afarensis (Maka), 2.5 Ma Au. garhi (Bouri), 1.0 Ma Homo erectus (Bouri), 0.64 Ma archaic H.sapiens (Bodo), and 0.15 Ma H. sapiens (Bouri).

26. Middle Awash area harbors deposits of a combined thickness of over 1 km. These deposits contain layers of volcanic tuffs, which are amenable to 39Ar/40Ar dating, and of clay, silt, sand, and carbonates. A segment of the stratigraphy (4.42 - 3.88 Ma) of the Middle Awash area, within which Ar. ramidus (bottom) and Au. anamensis (top) fossils reside, is shown.

27. Ardipithecus kadabba (kadabba = "family ancestor" in Afar) refers to a number of ~5.8 - 5.2 Ma fossils, so far represented only by teeth and fragments of skeletal bones. Apparently, these fossils are very similar to Ar. tchadensis and Ar. tugenensis. Still, derived dental characters of Ar. kadabba are shared exclusively with younger hominids. Thus, Ar. kadabba probably belongs to the hominid clade. Trajectory of evolution of the canine teeth early in the human clade. Right upper canine tooth of Ar. kadabba.

28. 4. Ar. ramidus Finally, at 4.42 Ma we encounter much more complete hominin fossils, known as Ar. ramidus ("ramid" = root in Afar). They were mostly found between two tuff layers in Middle Awash area deposited with an interval of less than100 Ka. The site where partial skeleton of Ar. ramidus was found, with its stratigraphic positions between two tuff layers, GATC and DABT shown.

29. Among Ar. ramidus fossils there is a partial skeleton, with most of the skull and teeth, pelvis,hands, and feet, which belong to a female that stood 120 cm and weighted ~50 kg, as well as various specimens from many other individuals. The site of discovery, partial skeleton, and reconstruction of Ar. ramidus.

30. Key facts about Ar. ramidus: Ar. ramidus skull is similar to that of Ar. tchadensis. Its cranial capacity, 300-350 cm3, is small, even relatively to body size. Ar. ramidus lacked prognathism of African great apes, implying that projecting jaws of gorillas and chimpanzees are the result of homoplasy. However, Ar. ramidus did have projecting midface. Teeth of Ar. ramidus suggest omnivory. Low δ13C in the enamel suggests a diet consisting mostly of plants that use the C3 photosynthesis. Because C4 photosynthesis is common in grasses of open habitats, this implies mostly forest or woodland feeding. Fossils of fruit-eating animals, as well as fossil wood, pollen, and seeds of trees, found together with Ar. ramidus tell the same story. Teeth of Ar. ramidus are small. Small canine teeth lacked sexual dimorphism, which suggest that within-species aggression was not common. Postcranial bones of Ar. ramidus show that it was capable both of bipedal terrestrial walking and of arboreal palmigrade clambering, as its feet were capable of grasping. Ar. ramidus was likely incapable of vertical climbing or knuckle-walking, again suggesting that the state of a phenotypic trait which is common to gorillas and chimpanzees may be a result of homoplasy.

31. Thus, it appears that HCLCA and the early stages of later evolution of the human clade were represented by small, non-specialized hominds, which had rather small brains, were both arboreal and bipedal (or, at least, evolved bipedality soon after the HCLCA), ate a variety of foods, and lacked many prominent adaptations of the extant great apes (prognathism and knuckle-walking). Ardipithecus likely represents the earliest segment of a single human lineage, whose next segment is called Australopithecus, and which later led to modern humans, as well as to now-extinct Paranthropus, non-African Homo erectus, and H. neanderthalensis. Indeed, simple ancestor-descendant relationships between Ardipithecus and Australopithecus (Hypothesis 1) are consistent will all data, and there are no evidence that they ever lived simultaneously.

32. Australopithecus segment of the human lineage The second segment of the human lineage known as Australopithecus (Southern Ape) covers the 4.3 - 2.5 Ma time interval. 1. Au. anamensis The earliest part of the Australopithecus segment is called Au. anamensis. Fossils of Au. anamensis date to 4.2 - 3.9 mya and were found near the Lake Turkana in Kenya and in the Middle Awash area. Some Au. anamensis fossils are superimposed on Ar. ramidus, and the two are separated by ~80 vertical meters of deposits which represent ~300,000 years. The fossils of Au. anamensis are fragmentary. Au. anamensis lived in a humid, woodland savannahs, where 25–35% of grasses had C4 photosynthesis, and did a lot of heavy chewing. Its bipedality was more advanced than in Ar. ramidus. Au. anamensis (center) was morphologically intermediate between Ar. ramidus (left) and Au. afarensis (rigth). In particular, its teeth were larger than in its ancestor.

33. 2. Au. afarensis Au. afarensis fossils span the range of 3.8 - 3.0 Ma and are known from the Middle Awash area, near-by Hadar, and several other localities in Ethiopia, Kenia, Tanzania, and Chad. They include a famous 3.2 Ma partial female skeleton named Lucy, a well-preserved 3.3 Ma skeleton and skull of a 3-year old girl from Dikika area (also within the Awash valley), named Selam, and teeth and bones of at least 13 individuals that apparently died together, collectively known as "First Family". Hadar and Dikika areas. Stratigraphy of Hadar. Lucy.

34. Selam, a skull and partial skeleton of Au. afarensis from Dikika. (left) anterior, lateral, and posterior views of the skull; (center) arm and leg bones; (right) dentition, hyoid bone, and manual phalanges.

35. 3.75 Ma footprints left in a layer of hardened volcanic ash were discovered in Laetoli, Tanzania. Probably, two Au. afarensis individuals left them as they walked across the savanna after a big eruption.

36. Key facts about Au. afarensis: Lucy stood ~ 1.3 m tall, and males were larger, but we do not know by how much. Cranial capacity of Au. afarensis was 400 - 450 cm3, slightly larger than that of Ar. ramidus. Au. afarensis had more projecting jaws than Ar. ramidus, and its craniofacial features, including relatively large molars with thick enamel, are likely adaptations to heavy chewing. Hyoid (lingual) bone of Au. afarensis is similar to that of chimpanzees and gorillas, and different from that of Homo; thus, Au. afarensis almost certainly could not speak. Upper body of Au. afarensis is still ape-lake, but its lower body is adapted for bipedal locomotion. In contrast to Ar. ramidus, the foot of Au. afarensis was not grasping, so that bipedal terrestrial walking was the main form of its locomotion. Still, it may have spent time in trees, as its gorilla-like scapula siggests. Fossils found with Au. afarensis, including many species of mammals, freshwater gastropods, fishes, and pollen, suggest that it inhabited a wide variety of environments, including mostly wooded areas, open grasslands, and river banks.

37. 3. Au. africanus 3.0 - 2.5 Ma interval of the Australopithecus segment of the human lineage is called Au. africanus and known from fossils found in South Africa. Cranium, jaws, and teeth of Au. africanus are well-represented, but postcranial fossils are rather poor. Au. africanus was similar to Au. afarensis, but its body and cranial capacity of ~460 cm3 were slightly larger and facial features were more humanoid. Still, Au. africanus had large chewing teeth and apart from the reduced canines the skull is relatively ape-like. Au. africanus ate large quantities of grasses and sedges with C4 photosynthesis and/or animals that fed on such plants. Au. africanus: Taung child (left), Mrs. Ples (center), and reconstruction (right).

38. Homo segment of the human lineage Homo, the third segment of our lineage, spans the time from 2.4 Ma until present. 1. H. habilis Fossils with cranial capacity 500 - 750 cm3, above that of Australopithecus, and smaller teeth, are known from 2.4 Ma at several East African localities. These fossils are mostly cranial and dental remains and only a few postcranial bones, and are attributed to Homo habilis. H. habilis was still similar to Australopithecus. Its face remained primitive, although it projected less. The back teeth are smaller than in A. africanus, but still larger than in modern humans. Like Australopithecus, H. habilis stood ~1.3 m and weighted 30-40 kg, and had similar limb proportions, in particular, long arms. Still, the brain shape in H. habilis was more humanlike than in Australopithecus. The bulge of Broca's area, essential for speech, is visible in the brain cast of one H.habilis. Homo habilis 1.8 Ma skull OH 24 (Twiggy) from Olduvai Gorge and reconstruction.

39. Also, H. habilis was likely the first regular maker of stone tools. Oldowan tools, discovered in the Olduvai Gorge, are the oldest kind of stone tools, consisting of cores and flakes, obtained by striking the cores on the edge. The oldest known Oldowan tools from the Hadar area are ~2.6 Ma, raising the possibility that their maker was late Australopithecus (or even early Paranthropus). However, most of known Oldowan tools were probably made by H. habilis. This tradition of making simple flakes struck off unmodified cores persisted until ~0.5 mya, alongside more sophisticated tools.

40. 2. H. erectus Fossil more similar to modern humans appear from ~1.8 Ma and are attributed to H. erects. They include a number of crania and one nearly-complete skeleton (Turkana boy). H. erects had a long low skull with cranial capacity between 750 cm3 and 1225 cm3, with the averages being ~900 cm3 for early specimens and ~1100 cm3 for late specimens. Like H. habilis, H. erects had face with protruding jaws with large molars, no chin, and thick brow ridges. The skeleton of H. erectus is more robust than those of modern humans. Body proportions vary; the Turkana Boy is tall and slender. H. erectus may be a direct descendant of H. habilis. Four skulls of H. erectus from East Africa. It is not clear if H. erectus originated from H. habilis through anagenesis or cladogenesis (Nature 448, 688-691, 2007), and whether there were other lineages of Homo 2.0-1.0Mya.

41. Turkana boy, 1.6 Ma skeleton of an 11-12 year old H. erectus boy, found near Lake Turkana in Kenya. The brain size was 880 cm3 (~910 cm3 at adulthood). A modern human of comparable size would have a brain size ~1350 cm3. The boy was 160 cm tall, and may be ~185 cm as an adult. Except for the skull, the skeleton is quite similar to that of modern boys.

42. Footprints discovered in two 1.53 and 1.51 Ma sedimentary layers at Ileret, Kenya were likely left by H. erectus. These footprints are distinct from the 3.75 Ma Laetoli footprints and show that by 1.5 Ma H. erectus had evolved an essentially modern human foot function and style of bipedal locomotion.

43. A pelvis of adult H. erectus female that lived of 1.4 - 0.9 Ma is obstetrically capacious and demonstrates that pelvic shape in H. erectus was evolving in response to increasing fetal brain size.

44. H. erectus apparently used fire and made stone tools more sophisticated than those of H. habilis. Acheulean tradition of stone tool-making, which replaced the more primitive Oldowan tradition, existed from 1.5 to ~0.2 Ma. Acheulean tools have been found in many of locations, sometimes alongside H. erectus fossils. The hand-axe that was the main feature of the Acheulean tradition was a multi-purpose instrument, suited to killing, slicing, dicing, chopping, rooting.

45. It is convenient to extend the temporal range of on H. erectus until ~0.6 Ma. However, the human lineage changed substantially between 1.8 and 0.6 Ma. For example, 1.0 Ma calvaria and postcranial remains of a H. erectus (Daka) are anatomically intermediate between earlier and later African fossils. Its endocranial capacity is relatively high at 995 cm3, but brow ridges are thick and strongly arched. Daka hominid was found with early Acheulean stone tools and a vertebrate fauna that indicates a savannah environment. Its temporal and geographic position indicates that African H. erectus was the ancestor of H. sapiens. Daka calvaria (top of the skull) which belongs to a 1.0 Ma H. erectus found at the Bouri site in Middle Awash. It is hard to regard this individual as H. sapiens.

46. 3. H. sapiens Anatomically modern humans evolved gradually (of course!) from H. erectus in Africa. Several transitional fossils are known. The boundary between H. erectus and H. sapiens can be put at 600 Ka, because it is probably unnatural to regard the ~600 Ka cranium from the Bodo site in Middle Awash as H. erectus. This cranium possesses a mixture of ancestral and derived trait states, but, crucially, its endocranial capacity was 1300 cm3, which is close to that of modern humans.

47. Fossils of two adult and one immature humans were discovered in the Herto Member, at the Bouri site in the Middle Awash. These 160 -154 Ka fossils are morphologically and chronologically intermediate between archaic African fossils and later anatomically modern humans, are associated with both Acheulean and Middle Stone Age tools, and probably represent the immediate ancestors of anatomically modern humans. Cranium of an adult H. sapiens from Herto.

48. Indeed, the morphology of the Herto crania falls between the more primitive morphology of the earlier African specimens, such as Bodo and Kabwe, and the more derived morphology of later anatomically modern H. sapiens, such as Qafzeh. Among the global sample of modern humans, the Herto crania lack any derived affinity with modern African crania or with any other group, which is to be expected for a common ancestor. There are no evidence of cladogenesis during the evolution of H. sapiens from H. erectus in Africa. From left to right, in anterior and lateral views, Bodo, Kabwe, Herto (boxed), and Qafzeh H. sapiens crania, with approximate time line.

49. 4. Origin of modern human diversity (or out-of-Africa 3) Genetic variation within modern humans show that our common ancestors lived in Africa until ~100-70 kya, after which some of them dispersed across the globe, reaching Australia ~30 kya and Americas ~15 kya. Indeed, all alleles present at a locus among modern humans can be traced to the common ancestral allele 100-400 Kya, and alleles found in non-African modern humans represent only one clade on the genealogy (phylogeny) of all human alleles.

50. Genetic variation is lower within populations that are further away from Africa. Apparently, during global expansion of humans new populations were often established by not too many individuals, and some alleled were lost.