1 / 37

S tructure of DNA

S tructure of DNA. Cellular DNA forms a double helix - two strands of DNA are held together by hydrogene bonds to form a duplex. Hydrogen bounding occurs between the laterally opposed complementary base pairing

lily
Download Presentation

S tructure of DNA

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Structure of DNA • Cellular DNA forms a double helix - two strands of DNA are held together by hydrogene bonds to form a duplex. • Hydrogen bounding occurs between the laterally opposed complementary base pairing • The bases are arranged in purine-pyrimidine pairs,adenine with thymine, guanine with cytosine, linked by hydrogen bonds.

  2. Structure of DNA • Cellular DNA forms a double helix - two strands of DNA are held together by hydrogene bonds to form a duplex. • Hydrogen bounding occurs between the laterally opposed complementary base pairing To form a chemically stable structure, the two DNA strands are antiparallel (have opposite polarity). That is, one strand running from the 5'-phosphate to 3'-OH is paired with the other strand arranged with its 3'-OH opposite the 5'-phosphate of the first strand, and its 5'-phosphate opposite the 3'-OH of the first strand.

  3. Replication of DNA • A portion of the double helix is unwound by a helicase. • A molecule of a DNA polymerase binds to one strand of the DNA and begins moving along it in the 3' to 5' direction, using it as a template for assembling a leading strand of nucleotides and reforming a double helix. In eukaryotes, this molecule is called DNA polymerase delta (δ). • Because DNA synthesis can only occur 5' to 3', a molecule of a second type of DNA polymerase (epsilon, ε, in eukaryotes) binds to the other template strand as the double helix opens. This molecule must synthesize discontinuous segments of polynucleotides (called Okazaki fragments). Another enzyme, DNA ligase I then stitches these together into the lagging strand.

  4. Summary Cellular DNA forms a double helix with complementary base pairing the two DNA strands are antiparallel DNA synthesis can only occur 5' to 3 on OH group at carbon 3 Used in methods like DNA hybridization (Lecture 2) PCR (Lecture2) Real-time PCR (Lecture 4) Sanger sequencing (Lecture 2) DNA microarray (Lecture4) Next gen sequencing (Lecture 4)

  5. Lecture 1 Human genome project, organization of the human genome and polymorphism of human DNA

  6. Chromosome banding • G banding – the chromosomes are subjected to controlled digestion with trypsin before staining with Giemsa, a DNA-binding chemical dye. Positively staining dark bands are known as G bands. Pale bands are G negative. • The International System for Human Cytogenetic Nomenclature Short arm p (petit) Long arm q (queue) HSA 4: human chromosome 4

  7. History • 1953: The primary structure of DNA is discovered by Watson and Crick • 1956: The first physical map (a map which provides information on the linear structure of DNA molecule) of the human genome is determined – light microscopy of stained tissue reveals that our cells contain 46 chromosomes, with a total of 24 different types of chromosome • 1977: Fred Sanger published the dideoxy DNA sequencing method which is still the basis of current DNA sequencing technology (Lecture 2) • 1980: Botstein proposed usage of restriction fragment length polymorphisms (RFLP) as landmarks in the DNA (Lecture 2)

  8. History • 1988: U.S. NIH sets up a National Center for Human Genome Research • 1988-89: The Human Genome Organization (HUGO) was established to coordinate international efforts; 3 major centers: • Bethesda for USA • London for Europe • Tokyo for Pacific • 1990: Official launch of the Human Genome Project (HGP) following implementation of 3 billion $ 15 year project in the U.S. • 2001 –publishing of working draft in journals Nature and Science • 2004 – finished sequence • 2008 Project Thousand genomes

  9. MAJOR EUKARYOTIC GENOME BROWSERS AND DATABASES • Ensembl http://www.ensemble.org NCBI map viewer http://www.ncbi.nlm.nih.gov/mapviewer • GenBank http://www.ncbi.nlm.nih.gov

  10. The human genome www.genome.gov/Education Collective name for the different DNA molecules found in the cells of Homo sapiens Comprises 25 different DNA molecules: 1. Nuclear genome: 24 different linear nuclear DNA molecules – 22 autosomes and 2 sex chromosomes X and Y, app. 21,000 protein coding genes and more than 6000 RNA genes 2. Mitochondrial genome: a single type of circular mitochondrial DNA, 37 genes

  11. Nuclear genome • Size: 3200 Mb • Number of different DNA molecules: 23 (in XX cells) or 24 (in XY cells); all linear • Total number of molecules per cell: 46 in diploid cells • Number of protein-coding genes: app. 21,000 • Number of RNA genes: uncertain, but more than 6000 • Protein-coding DNA: app. 1.1% • Noncoding DNA: 98,9% - 4 % conserved other than coding sequences - 6,5% constitutive heterochromatin (a chromosomal region that remains highly conserved throughout the cell cycle and shows little or no evidence of active gene expression) - 45% transposon based repeats - 44% other non conserved ( incl. repetitive sequences) Human Molecular Genetics, Strachan 2011

  12. Mitochodrial genome • Size: 16.6 kb • Number of different DNA molecules: one circular DNA molecule • Total number of molecules per cell: often several thousands • Number of protein-coding genes: 13 • Number of RNA genes : 24 RNAs genes • Protein-coding DNA: 66% • RNA-coding DNA: 32% Human Molecular Genetics, Strachan 2011

  13. Protein- coding genes 1.1% , other conserved sequences 4% Number of protein-coding genes: app. 21,000 Number of RNA genes: more than 6000 Molecular definition of a gene Sequence of chromosomal DNA that is required for production of a functional product, be it a polypeptide or a functional RNA molecule inclusive regulatory sequences

  14. Gene prediction by detection of CpG islands – overall frequency of CpG in the human genome is low CG rich (more than 50%) unmethylated or hypomethylated DNA sequence of about hundreds nucleotides long with significant frequency of CpG dinucleotides are target for DNA methylation that can cause local condensation of chromatin and inhibit gene expression

  15. Polypeptide-conding genes • Single copy genes • Gene families - duplication of single copy genes • degree of sequence similarity and structural similarity If two different genes make very similar protein products, they are most likely to be originated by an evolutionary very recent gene duplication and tend to be clustered togheter - clustered or dispersed trough genome

  16. Gene families with genes with high degree of sequence homology over most of the length of the gene or coding sequence histone genes – 86 different histone sequences distributed over 10 different chromosomes; two large clusters α-globin and β-globin genes

  17. Gene families defined by common protein domain, the members may have low sequence homology, but they posses certain sequences that specify one or more specific protein domains

  18. 3. Gene superfamilies– the members are much distantly related in evolutionary terms; they encode products that are functionally related in a general sense, and show only weak sequence homology over a large segment without very significant conserved amino acid motif , but common structural features - general related function Immunoglobulin superfamily – very large family encompassing immunoglobulin (Ig) genes, TCR and HLA genes products are considerably divergent at the DNA level but which function in the immune system and contain Ig-like domain.

  19. Major clases of human noncoding (nc)RNA • Ribosomal RNA • Transfer RNA • Small nuclear RNA • Small nucleolar RNA • Smal Cajal body RNA • Ribonucleases RNA • Micro RNA • Piwi-binding RNA • Endogenous short interfering RNA • Long noncoding regulatory RNA

  20. microRNA ca. 1000 different types, about 22 nt size regulating RNA, antisense regulation of other genes Interference RNA (RNAi) is RNA regulation (RNA cleavage and degradation( by interference with small regulatory RNA; based on base complementarity's; trigger is micro RNA, but RNAi detected by introducing of ds RNA into cells

  21. Tandemly repeated noncoding human DNA 1.Satellite DNA – often occurs in arrays (blocks) within 100 kb to several Mb size range - size of repeat unit is 5-171 bp - especially at centromers; not transcribed Alphoid DNA – bulk of the centromeric heterochromatine; repeat unit 171 bp; important for centromere function 2.Minisatellite DNA – arrays within 0,1 kb to 20 kb range - repeat unit 9-64 bp Telomeric family – 3-20 kb tandemof hexanuklaotide repeat units, especially TTAGGG, which are added by specialized enzyme telomerase; acting as buffer to protect the ends of the chromosomes Hypervariable - high polymorphic (various individual loci), organized in over 1000 arrays (0,1 to 20 kb long)

  22. Tandemly repeated noncoding human DNA Microsatellite DNA(simple sequence repeats;SSR or STR =short tandem repeats) - small arrays of tandem repeats of a simple sequence (usually less than 10 bp; interspersed through genome, accounting for over 60 Mb (2% of the genome) - arises by replication splippage CA/TG repeats are very common, accounting for about 0.5% of the genome and are often highly polymorphic tri,-, tetra and pentanucleotide repeats Application in forensic , gene mapping, indirect diagnostics, molecular oncology

  23. Interspersed noncoding DNA derived from transposones close 45% of the genome can be recognized as belonging to this class Transposones – mobile DNA elements which can migrate to different regions of the genome In humans and other mammals there are 4 class detected They can be organized in 2 groups according to the method of transposition retrotransposons – reverse transcriptase makes cDNA copies of RNA transcripts and and machinery of replicative transposition inserts them elsewhere into genome LINES long interspersed nucler elements 20% of the genome; okolo 1 000 000 copies SINES short interspersed nuclear elements 13,5% genome; about 1 750 000 copies; e.g. ALU REPEATS

  24. ALU REPEATS – the most abundant sequence in the human genome . 1 200000 copies accounts for 10.7 % of the genome . occurs about once every 3 kb in human DNA - originates from 7SL RNA from SRP (signal recognition particle) Hot spot for recombination

  25. DNA polymorphism • stricktly – the existence of two or more variants at significant frequencies in the populations; • Looser – usage among molecular geneticist include • Any sequence variants present at a frequency more than 1% in a population • Any non-pathogenic sequence variant, regardless of frequency

  26. DNA polymorphism • Single nucleotide polymorphism (SNP)– single base substitution public dbSNP http://ncbi.nlm.nih.gov/projects/SNP • Designed by numbering beginning with rs(reference SNP) • Variable number of tandem repeats (VNTR) – describes alleles at loci containing tandelmy repeated runs of a simple sequence • Microsatellites – STR (shor tandem repeats) • MinisatelliteDNA polymorphism - • Copy number variations

  27. Three types of single nucleotide polymorphisms SNP Substitution Substitution resulting in RSP Insertion/ deletion In most cases, a SNP has to alternative forms (alleles) say A or G at a certain position. The frequency of the minor rarer allele may be anything from 0.5 downward. We would not expect high-frequency SNP alleles to have any major phenotypic effect, because natural selection should have ensured that they were eliminated if harmful or fixed if beneficial. Some polymorphism sites have more complex variants. A SNP may have three alleles, say A,G or C or two SNP may be adjacent to one another. The great majority of more complex variants in the dbSNP (about 2 milions from 12 millions entries are deletion/insertion polymorphisms). Typically one or two non- repeated nucleotides are deleted or inserted. Sometimes a SNP affect a nucleotide that is part of the recognition site for a restriction enzyme. Thus the polymorphisms will create or abolish a restriction site. SNPs of this type known as restriction fragment length polymorphisms or restriction site polymorphisms (RSP) were first widely used DNA markers

  28. DNA polymorphism • Single nucleotide polymorphism (SNP)– single base substitution public dbSNP http://ncbi.nlm.nih.gov/projects/SNP • Designed by numbering beginning with rs(reference SNP) • Variable number of tandem repeats (VNTR) – describes alleles at loci containing tandelmy repeated runs of a simple sequence • Microsatellites – STR polymorphisms • MinisatelliteDNA polymorphism • Copy number variations – variable number of copies of sequences of at least 1 kb in length

  29. Short tandem repeats (microstallites) – improtant for family and forensic studies • 1989 (short tandem repeats STR) • about 150,000 STR have been indetified • Usually di-, tri- and tetra-nucleotide repeats; mostly (CA)n repeats • Many alleles, highly informative • Can type by automated multiplex PCR • Easy physical localization • Distributed through genome 1 tctaattaaa gtggtgtccc agataatctg tactaataaa agtatatttt aatagcaagt 61 atgtgacaag ggtgattttc ctctttggta tccttatgta atattttgaa gatagataga 121 tagatagatagatagataga tagatagatagataggtagatagaggtata aataaggata 181 cagatatagn tacaaatgtt gtaaactgtg gctatgattg gaatcacttg gctaaaaagc 241 gctnaagcnt tcctctgnga gaggcaatta cttttttnct taggnactnc ctcancagtc

  30. Genetic markers • Characteristic located at the same place on a pair of homologous chromosomes that allow us distinguish one homolog from the other • Most commonly DNA sequence polymorphism that can be detected by PCR amplification of the segment of DNA containig the markers (lecture 2, lecture 4)

  31. Students scietific conference topics Analysis of SNP´s in preeclamptic patients Detection of DNA methylation in cervical cancer

  32. Diploma thesis • Molecular biology of HPV infection • Differential gene expression in placenta

More Related