Genomic DNA, Genes, Chromatin

1. Genomic DNA, Genes, Chromatin Dr. Nabil Bashir

2. Genomic DNA, Genes, Chromatin a). Genetic dogma b). forces that affect DNA double helical stability c). Complexity of chromosomal DNA i). DNA denaturation ii).Repetitive DNA and Alu sequences iii). Genome size and complexity of genomic DNA d). Gene structure i). Introns and exons ii). Properties of the human genome iii). Mutations caused by Alu sequences e). Chromosome structure - packaging of genomic DNA i). Nucleosomes ii). Histones iii). Nucleofilament structure

3. DNA, Genes, ChromatinLearning Objectives • Know what is meant by Genetic dogma • Understand the nature of the forces contributing to the stability of the DNA double helix • Understand the process of DNA denaturation and the relationship between melting temperature and the base composition of DNA • know what repetitive sequences are and how they are arranged in the human genome • Understand the mechanism by which Alu sequences have affected the LDL receptor gene • recognize basic gene structure. • Know the basic characteristics of human nuclear and mitochondrial DNA • Understand basic chromosome structure and how DNA is packaged into chromosomes

4. THE FLOW OF GENETIC INFORMATION 2 3 DNA RNA PROTEIN 1 DNA 1. REPLICATION (DNA SYNTHESIS) 2. TRANSCRIPTION (RNA SYNTHESIS) 3. TRANSLATION (PROTEIN SYNTHESIS)

5. 5-Methylcytosine (5mC). A common base modification in DNA results from the methylation of cytosine, giving rise to 5-methylcytosine (5mC). 5mC is highly mutagenic. (5mC) residues are often clustered near the promoters of genes in so-called "CpG islands.“ The problem that arises from these methylations is that subsequent deamination of a 5mC results in the production of thymine, which is not foreign to DNA. As such, 5'-mCG-3' sites (or mCpG sites) are "hot-spots" for mutation, and when mutated are a common cause of cancer.

6. Structure

7. Structure

8. One Strand of DNA Structure

9. Introduction Structure

10. Introduction Structure

11. DNA Structure

12. DNA Forms

13. Forces affecting the stability of the DNA double helix • hydrophobic interactions - stabilize • - hydrophobic inside and hydrophilic outside • stacking interactions - stabilize • - relatively weak but additive van der Waals forces • hydrogen bonding - stabilize • - relatively weak but additive and facilitates stacking • electrostatic interactions - destabilize • - contributed primarily by the (negative) phosphates • - affect intrastrand and interstrand interactions • - repulsion can be neutralized with positive charges • (e.g., positively charged Na+ ions or proteins)

14. Stacking interactions Charge repulsion Charge repulsion

15. Denaturation of DNA Strand separation and formation of single-stranded random coils Double-stranded DNA Extremes in pH or high temperature A-T rich regions denature first Cooperative unwinding of the DNA strands

16. Electron micrograph of partially melted DNA Double-stranded, G-C rich DNA has not yet melted A-T rich region of DNA has melted into a single-stranded bubble • A-T rich regions melt first, followed by G-C rich regions

17. Hyperchromicity Absorbance maximum for single-stranded DNA Absorbance maximum for double-stranded DNA Absorbance 220 260 300 The absorbance at 260 nm of a DNA solution increases when the double helix is melted into single strands.

18. DNA melting curve 100 50 Percent hyperchromicity 0 50 70 90 Temperature oC • Tm is the temperature at the midpoint of the transition

19. Tm is dependent on the G-C content of the DNA E. coli DNA is 50% G-C Percent hyperchromicity 50 60 70 80 Temperature oC Average base composition (G-C content) can be determined from the melting temperature of DNA

20. Type of DNA % of Genome Features Single-copy (unique) ~75% Includes most genes 1 Repetitive Interspersed ~15% Interspersed throughout genome between and within genes; includes Alu sequences 2 Satellite (tandem) ~10% Highly repeated, low complexity sequences usually located in centromeres and telomeres 2Alu sequences are about 300 bp in length and are repeated about 300,000 times in the genome. They can be found adjacent to or within genes in introns or nontranslated regions. 1 Some genes are repeated a few times to thousands-fold and thus would be in the repetitive DNA fraction

21. Classes of repetitive DNA Interspersed (dispersed) repeats (e.g., Alu sequences) GCTGAGG GCTGAGG GCTGAGG Tandem repeats (e.g., microsatellites) TTAGGGTTAGGGTTAGGGTTAGGG

22. Gene structure promoter region exons (filled and unfilled boxed regions) +1 introns (between exons) transcribed region mRNA structure 5’ 3’ translated region

23. The (exon-intron-exon)n structure of various genes introns can be very long, while exons are usually relatively short. histone total = 400 bp; exon = 400 bp b-globin total = 1,660 bp; exons = 990 bp HGPRT (HPRT) total = 42,830 bp; exons = 1263 bp factor VIII total = ~186,000 bp; exons = ~9,000 bp

24. Human Genome Project • Knowing the complete sequence of the human genome will: • allow medical researchers to more easily find disease-causing genes. • understand how differences in our DNA sequences from individual to individual may affect our predisposition to diseases and our ability to metabolize drugs.

25. Properties of the human genome • Nuclear genome • the haploid human genome has ~3 X 109 bp of DNA • single-copy DNA comprises ~75% of the human genome • the human genome contains ~20,000 to 25,000 genes • most genes are single-copy in the haploid genome • genes are composed of from 1 to >75 exons • genes vary in length from <100 to >2,300,000 bp • Alu sequences are present throughout the genome • Mitochondrial genome • circular genome of ~17,000 bp • contains <40 genes

26. Alu sequences can be “mutagenic” • Familial hypercholesterolemia • autosomal dominant • LDL receptor deficiency From Nussbaum, R.L. et al. "Thompson & Thompson Genetics in Medicine," 6th edition (Revised Reprint), Saunders, 2004.

27. LDL receptor gene Alu repeats present within introns 4 5 6 Alu repeats in exons unequal crossing over 4 5 6 Alu Alu X Alu Alu 4 5 6 one product has a deleted exon 5 (the other product is not shown) Alu 4 6

28. Chromatin structure EM of chromatin shows presence of nucleosomes as “beads on a string”

29. Nucleosome structure • Nucleosome core (left) • 146 bp DNA; 1 3/4 turns of DNA • DNA is negatively supercoiled • two each: H2A, H2B, H3, H4 (histone octomer) • Nucleosome (right) • ~200 bp DNA; 2 turns of DNA plus spacer • also includes H1 histone

30. Histones (H1, H2A, H2B, H3, H4) • small proteins • arginine or lysine rich: positively charged • interact with negatively charged DNA • can be extensively modified - modifications in • general make them less positively charged • Phosphorylation • Poly(ADP) ribosylation • Methylation • Acetylation • Hypoacetylation • by histone deacetylase (facilitated by Rb) • “tight” nucleosomes • assoc with transcriptional repression • Hyperacetylation • by histone acetylase (facilitated by TFs) • “loose” nucleosomes • assoc with transcriptional activation

31. Nucleofilament Structure • The orderly packaging of DNA in the cell is essential for the process of DNA replication, as well as for the process of transcription. • Packaging of DNA into nucleosomes is only the first step, foreshortening chromosomal • DNA needs to be packaged in higher-order structures first into closely packed arrays of nucleosomes called nucleofilaments, which are then coiled into thicker and thicker filaments.

34. HIGHLIGHTS 1. A common base modification in DNA results from the methylation of cytosine, giving rise to 5-methylcytosine (5mC). 2. 5mC is highly mutagenic. It is believed that this methylation functions to regulate gene expression because 5-methylcytosine (5mC) residues are often clustered near the promoters of genes in so-called "CpG islands.“ 3. The problem that arises from these methylations is that subsequent deamination of a 5mC results in the production of thymine, which is not foreign to DNA. As such, 5'-mCG-3' sites (or mCpG sites) are "hot-spots" for mutation, and when mutated are a common cause of cancer.

35. 4. Three types of forces contribute to maintaining the stability of the DNA double helix: 1) hydrophobic interactions, 2) stacking interactions, and 3) hydrogen bonding. The base pairs in the interior of the DNA molecule create a hydrophobic environment, with the negatively charged phosphates along the backbone being exposed to the solvent. Thus, in an aqueous environment, the double-stranded structure is stabilized by the hydrophobic interior. Reagents that solubilize the DNA bases (e.g., methanol) destabilize the double helix. Stacking interactions and hydrogen bonding interactions are relatively weak but additive. Reagents that disrupt hydrogen bonding [e.g., formamide, urea, and solutions with very low pH (pH <2.3) or very high pH (pH >10)] destabilize the double helix. 5. Electrostatic replusion by negatively charged phosphates along the DNA backbone destabilize the double helix. For example, if the phosphates are left unshielded, as when DNA is dissolved in distilled water, the DNA strands will separate at room temperature. Neutralizing these negative charges by the addition of NaCl (which contributes positively charged sodium ions) to the DNA solution will prevent strand separation. In the cell, the phosphates also interact with positively charged (magnesium, potassium, or sodium) ions and with positively charged (basic) proteins.

36. Types of human DNA 6. The human genome consists of three populations of DNA: the fast and intermediate fractions make up about 10% and 15% of the genome, respectively, and the slow fraction makes up about 75% of the genome. Most of the genes in the human genome are in the single-copy fraction. As shown in the next slide, repeated sequences can be of two types: those that are interspersed throughout the genome or those that are tandemly repeated satellite DNAs. Among the interspersed repetitive sequences are so-called "Alu" sequences, which are about 300 base pairs in length and are repeated about 300,000 times in the genome. They can be found adjacent to or within genes, and as illustrated later, their presence can sometimes lead to the occasional disruption of genes.

37. Gene Structure 7. Most genes in the human genome are called "split genes" because they are composed of "exons" separated by "introns." 8. The exons are the regions of genes that encode information that ends up in mRNA. 9. The transcribed region of a gene (double-ended arrow) starts at the +1 nucleotide at the 5' end of the first exon and includes all of the exons and introns (initiation of transcription is regulated by the promoter region of a gene, which is upstream of the +1 site). 10. RNA processing (the subject of a another lecture) then removes the intron sequences, "splicing" together the exon sequences to produce the mature mRNA. 11. The translated region of the mRNA (the region that encodes the protein) is indicated in blue. Note that there are untranslated regions at the 5' and 3‘ ends of mRNAs that are encoded by exon sequence but are not directly translated.

38. The (exon-intron-exon)n structure of various genes introns can be very long, while exons are usually relatively short. 12. wide variety of gene structures seen in the human genome. Some (very few) genes do not have introns. One example is the histone genes, which encode the small DNA-binding proteins, histones H1, H2A, H2B, H3, and H4. 13. histone gene that is only 400 base pairs (bp) in length and is composed of only one exon. 14. The beta-globin gene has three exons and two introns. 15. The hypoxanthine-guanine phosphoribosyl transferase (HGPRT or HPRT) gene has nine exons and is over 100-times larger than the histone gene, yet has an mRNA that is only about 3-times larger than the histone mRNA (total exon length is 1,263 bp).

39. Alu sequences can be “mutagenic” 16. familial hypercholesterolemia (FH): autosomal dominant disease,, is caused by mutations in the LDL (low density lipoprotein) receptor gene . 17.Plasma LDL, which carries circulating cholesterol, is cleared from the serum by binding to the LDL receptor on liver cells and is internalized. 18. Normal plasma cholesterol levels average below 200 mg/dl. Individuals who have one defective LDL receptor gene (heterozygous) have approximately double this amount, and those with two defective genes (homozygous) have approximately four times this amount. 19. Heterozygous individuals are predisposed to cardiovascular disease, with males having a 50% risk of myocardial infarction by age 50. 20. There are many ways that the LDL receptor gene has been mutated rendering it inactive or abnormal. As shown in the next figure, one mechanism has involved Alu sequences.

40. Chromatin Structure 21. The appearance of a "beads on a string" structure is due to regularly spaced nucleosomes (see next slide). 22. "Chromatin" is the biochemical term for DNA-protein complexes that are isolated from eukaryotic chromosomes.

41. LDL Receptor Gene 23. Here you see the structure of the LDL receptor gene (which has 18 exons). Six Alu sequences are present within three of the introns and two of the exons. Because of the close proximity of the two Alu repeats located within introns 4 and 5, unequal crossing over can occur during meiosis. Crossing over (the topic of a future lecture) requires homologous sequences, which base pair with each other during the process of meiosis. The homologous sequences can be provided by the Alu repeats, which can cause an out-of-register misalignment and subsequent crossing over deleting exon 5 from one of the two products of crossing over. This exon 5 in-frame deletion can be inherited and is currently a cause of FH. This deletion affects the LDL binding region of the receptor. Thus, while Alu sequences have no known function in our genomes, there are a lot of them scattered throughout our genomes, within and around genes, and they can be quite disruptive.

42. Nucleosome Structure 24. Each nucleosome is composed of a core (left) consisting of two each of the histones, H2A, H2B, H3, and H4, around which the DNA winds 1 3/4 times. The DNA undergoes negative supercoiling as a consequence of being wound around the core histones. Histones are positively charged proteins and thus interact with the negatively charged phosphates along the backbone of the DNA double helix. While the core has 146 bp of DNA, the nucleosome proper (right) has approximately 200 bp of DNA and also includes one histone H1 monomer lying on the outside of the structure. Nucleosomes are regularly spaced along eukaryotic chromosomal DNA every ~200 bp, giving rise to the "beads on a string" structure.

43. Histones (H1, H2A, H2B, H3, H4) 25. Histones are small, positively charged proteins that can be extensively modified posttranslationally, in general to make them less positively charged. 26. Histone deacetylases (HDACs) are associated with transcriptional repression because they make histones better able to bind DNA, thus making DNA less accessible to the transcription machinery. Histone deacetylases are recruited to the chromosome by transcriptional repressors such as the retinoblastoma (Rb) protein (the subject of another lecture). 27. Histone acetylases are recruited to chromosomes by transcription factors (TFs). Histone acetylases reduce the positive charges on histones, causing them to loosen their grip on the DNA to allow transcription factors to bind.

44. Nucleofilament Structure 28. The orderly packaging of DNA in the cell is essential for the process of DNA replication, as well as for the process of transcription. 29. Packaging of DNA into nucleosomes is only the first step, foreshortening chromosomal 30. DNA needs to be packaged in higher-order structures first into closely packed arrays of nucleosomes called nucleofilaments, which are then coiled into thicker and thicker filaments.