Using a Single Nucleotide Polymorphism to Predict Bitter-Tasting Ability

1. Using a Single Nucleotide Polymorphism to Predict Bitter-Tasting Ability Can you Taste PTC ?

2. Taste in Mammals • Mammals can distinguish only five basic tastes • Sweet • Sour • Bitter • Salty • Umami (the taste of monosodium gluatmate)

3. Taste in Mammals • Taste perception is a two-step process • 1st…A taste molecule binds to a specific receptor on the surface of a taste cell • 2nd …The taste cell generates a nervous impulse, which is interpreted by the brain

5. An Example: Taste in Mammals • Stimulation of “sweet cells” generates a perception of sweetness in the brain • Taste sensation is ultimately determined by the wiring of a taste cell to the cortex in the brain • If you have a sweet cell • But it expresses a “bitter taste receptor” • Bitter molecule will be perceived as being sweet!

6. Taste in Mammals • Taste recognition is mediated by specialized taste cells that communicate with several brain regions through direct connections to sensory neurons

7. While there are only 5 tastes there are thousand more olefactory (smell) receptors (OR) • Smell is like taste—a receptor – a protein that binds to a molecule that we smell. • Similar also to how many drugs work (the drug binds to a cell protein—or receptor) • All are coded by specific genes

8. A Serendipitous Observation • The genetic basis of taste first observed by accident in 1930’s • PTC = phenylthiocarbamide • Prepared by Arthur Fox at Du Pont Company in late 1920s • Lab partner C.R. Noller complained of bitter taste but Fox had no taste

9. Albert Blakeslee with Jimson WeedCarnegie Department of Genetics, Cold Spring Harbor, New York, 1933 • Followed up by Albert Blakeslee at Carnegie Department of Genetics showed that inability to taste is recessive • Published in 1932

10. Albert Blakeslee, AAAS Convention, 1938

11. Punnett Square

12. Molecular Genetics of PTC Tasting • Gene identified in 2003 by Dennis Drayna TAS2R38 gene • Polymorphism associated with PTC tasting • SNP(Single Nucleotide Polymorphism)--at position 145 Taster = C Nontaster = G • Change in Amino acid 49 …. (proline)  (alanine)

13. Analysis of the Trait--CAPS • Cleavage amplified polymorphisms • Amplify a region of TAS2R38 gene by PCR • Primers used in the experiment: CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG AGGTTGGCTTGGTTTGCAATCATC • Then cut with restriction enzyme (HaeIII) • RFLP-Restriction Fragment Length Polymorphism

15. Analysis by eletrophoresis

16. 2% Agarose Gel Electrophoresis

17. What is the relationship between this trait and our ancestors? • What is the normal state? To taste or to not taste?

18. Multiple Sequence Alignment

19. Advantage: Taste or not to taste?

20. More Complication: More than 1 PTC Haplotypes

21. How does HaeIII Cut the taster allele? Hae III restriction site = GGCC In the regions around the 145 SNP Taster 141 GCAGGCAGCCACT Nontaster 141 GCAGGCAGGCACT

22. http://bioinformatics.dnalc.org/ptc/animation/ptc.html

23. After PCR • HaeIII cut site Taster TAGTGAAGAGGCGGCCACTG Nontaster TAGTGAAGAGGCGGGCACTG

24. How does the Hae III enzyme discriminate between the C-G polymorphism in the TAS2R38 gene. • HaeIII cuts at the sequence GGCC • This is at the 143-145 position of the gene • The nontaster has a GGGC and won’t cut

25. Many people are nontasters…more than what is expected if bitter taste was the ONLY trait under natural selection SO…. Is there some factor that makes this a positive outcome to balance out the negative effect of not tasting bitter? Is there an advantage to being a heterozygote (like sickle cell anemia)? Maybe….Maybe the NONTASTING form allow for individuals to taste another type of bitter molecule and so these people may know to avoid potentially toxic compounds.

26. How are these techniques different from that used in forensic crime lab? • We use a SNP and RFLP • Restriction fragment length polymorphism, or RFLP (commonly pronounced “rif-lip”), is a technique that exploits variations in homologous DNA sequences. It refers to a difference between samples of homologous DNA molecules that come from differing locations of restriction enzyme sites and to a related laboratory technique by which these segments can be illustrated. In RFLP analysis, the DNA sample is broken into pieces (digested) by restriction enzymes and the resulting restriction fragments are separated according to their lengths by gel electrophoresis.

27. Forensics Labs use: • Variable Number Tandem Repeat (VNTR)-A tandem repeat is a short sequence of DNA that is repeated in a head-to-tail fashion at a specific chromosomal locus. Tandem repeats are interspersed throughout the human genome. Some sequences are found at only one site -- a single locus -- in the human genome. For many tandem repeats, the number of repeated units vary between individuals. Such loci are termed VNTRs. One VNTR in humans is a 17 bp sequence of DNA repeated between 70 and 450 times in the genome. The total number of base pairs at this locus could vary from 1190 to 7650.

28. A short tandem repeat (STR) in DNA occurs in non-coding region when a pattern of two or more nucleotides are repeated and the repeated sequences are directly adjacent to each other. The pattern can range in length from 2 to 5 bp bp (for example (CATG)n in a genomic region) and is typically in the non-coding intron region. • A short tandem repeat polymorphism (STRP) occurs when homologous STR loci differ in the number of repeats between individuals. By identifying repeats of a specific sequence at specific locations in the genome, it is possible to create a genetic profile of an individual. There are currently over 10,000 published STR sequences in the human genome. STR analysis has become the prevalent analysis method for determining genetic profiles in forensic cases.