Clinical and Molecular Characterization of Collagen VI Myopathies

1. Clinical and Molecular Characterization of Collagen VI Myopathies Russell Butterfield MD/PhD University of Utah Departments of Neurology and Pediatrics August 15, 2010

2. Collagen VI myopathies • Bethlem Myopathy • Proximal muscle weakness and atrophy • Dynamic contractures in distal joints (fingers, wrists, elbows, and ankles) • Onset in first or second decade • Slowly progressive in adult years • 2/3 of patients >50 years-old require assistance for ambulation • Ullrich Congenital Muscular Dystrophy • Severe weakness/hypotonia in early infancy • Proximal joint contractures • Distal joint hyperlaxity • Collagen VI myopathies likely represent spectrum of phenotypes defined by type and distribution of contractures

3. Three genes of Collagen VI N1 C1 TH C2 a1(VI) C a2(VI) • C N10 N9 N8 N7 N6 N5 N4 N3 N2 N1 TH C1 C2 C3 C4 C5 a3(VI) C Alternatively spliced vWF A von Willebrand factor A domain Lysine/proline repeats Triple-helix Kunitz protease inhibitor motif Fibronectin type III motif

4. COL6A1- 4246 base pairs • gctctcactctggctgggagcagaaggcagcctcggtctctgggcggcggcggcggccca ctctgccctggccgcgctgtgtggtgaccgcaggccccagacatgagggcggcccgtgct ctgctgcccctgctgctgcaggcctgctggacagccgcgcaggatgagccggagaccccg agggccgtggccttccaggactgccccgtggacctgttctttgtgctggacacctctgag agcgtggccctgaggctgaagccctacggggccctcgtggacaaagtcaagtccttcacc aagcgcttcatcgacaacctgagggacaggtactaccgctgtgaccgaaacctggtgtgg aacgcaggcgcgctgcactacagtgacgaggtggagatcatccaaggcctcacgcgcatg cctggcggccgcgacgcactcaaaagcagcgtggacgcggtcaagtactttgggaagggc acctacaccgactgcgctatcaagaaggggctggagcagctcctcgtggggggctcccac ctgaaggagaataagtacctgattgtggtgaccgacgggcaccccctggagggctacaag gaaccctgtggggggctggaggatgctgtgaacgaggccaagcacctgggcgtcaaagtc ttctcggtggccatcacacccgaccacctggagccgcgtctgagcatcatcgccacggac cacacgtaccggcgcaacttcacggcggctgactggggccagagccgcgacgcagaggag gccatcagccagaccatcgacaccatcgtggacatgatcaaaaataacgtggagcaagtg tgctgctccttcgaatgccagcctgcaagaggacctccggggctccggggcgaccccggc tttgagggagaacgaggcaagccggggctcccaggagagaagggagaagccggagatcct ggaagacccggggacctcggacctgttgggtaccagggaatgaagggagaaaaagggagc cgtggggagaagggctccaggggacccaagggctacaagggagagaagggcaagcgtggc atcgacggggtggacggcgtgaagggggagatggggtacccaggcctgccaggctgcaag ggctcgcccgggtttgacggcattcaaggaccccctggccccaagggagaccccggtgcc tttggactgaaaggagaaaagggcgagcctggagctgacggggaggcggggagaccaggg agctcgggaccatctggagacgagggccagccgggagagcctgggccccccggagagaaa ggagaggcgggcgacgaggggaacccaggacctgacggtgcccccggggagcggggtggc cctggagagagaggaccacgggggaccccaggcacgcggggaccaagaggagaccctggt gaagctggcccgcagggtgatcagggaagagaaggccccgttggtgtccctggagacccg ggcgaggctggccctatcggacctaaaggctaccgaggcgatgagggtcccccagggtcc gagggtgccagaggagccccaggacctgccggaccccctggagacccggggctgatgggt gaaaggggagaagacggccccgctggaaatggcaccgagggcttccccggcttccccggg tatccgggcaacaggggcgctcccgggataaacggcacgaagggctaccccggcctcaag ggggacgagggagaagccggggaccccggagacgataacaacgacattgcaccccgagga gtcaaaggagcaaaggggtaccggggtcccgagggcccccagggacccccaggacaccaa ggaccgcctgggccggacgaatgcgagattttggacatcatcatgaaaatgtgctcttgc tgtgaatgcaagtgcggccccatcgacctcctgttcgtgctggacagctcagagagcatt ggcctgcagaacttcgagattgccaaggacttcgtcgtcaaggtcatcgaccggctgagc cgggacgagctggtcaagttcgagccagggcagtcgtacgcgggtgtggtgcagtacagc cacagccagatgcaggagcacgtgagcctgcgcagccccagcatccggaacgtgcaggag ctcaaggaagccatcaagagcctgcagtggatggcgggcggcaccttcacgggggaggcc ctgcagtacacgcgggaccagctgctgccgcccagcccgaacaaccgcatcgccctggtc atcactgacgggcgctcagacactcagagggacaccacaccgctcaacgtgctctgcagc cccggcatccaggtggtctccgtgggcatcaaagacgtgtttgacttcatcccaggctca gaccagctcaatgtcatttcttgccaaggcctggcaccatcccagggccggcccggcctc tcgctggtcaaggagaactatgcagagctgctggaggatgccttcctgaagaatgtcacc gcccagatctgcatagacaagaagtgtccagattacacctgccccatcacgttctcctcc ccggctgacatcaccatcctgctggacggctccgccagcgtgggcagccacaactttgac accaccaagcgcttcgccaagcgcctggccgagcgcttcctcacagcgggcaggacggac cccgcccacgacgtgcgggtggcggtggtgcagtacagcggcacgggccagcagcgccca gagcgggcgtcgctgcagttcctgcagaactacacggccctggccagtgccgtcgatgcc atggactttatcaacgacgccaccgacgtcaacgatgccctgggctatgtgacccgcttc taccgcgaggcctcgtccggcgctgccaagaagaggctgctgctcttctcagatggcaac tcgcagggcgccacgcccgctgccatcgagaaggccgtgcaggaagcccagcgggcaggc atcgagatcttcgtggtggtcgtgggccgccaggtgaatgagccccacatccgcgtcctg gtcaccggcaagacggccgagtacgacgtggcctacggcgagagccacctgttccgtgtc cccagctaccaggccctgctccgcggtgtcttccaccagacagtctccaggaaggtggcg ctgggctagcccaccctgcacgccggcaccaaaccctgtcctcccacccctccccactca tcactaaacagagtaaaatgtgatgcgaattttcccgaccaacctgattcgctagatttt ttttaaggaaaagcttggaaagccaggacacaacgctgctgcctgctttgtgcagggtcc tccggggctcagccctgagttggcatcacctgcgcagggccctctggggctcagccctga gctagtgtcacctgcacagggccctctgaggctcagccctgagctggcgtcacctgtgca gggccctctggggctcagccctgagctggcctcacctgggttccccaccccgggctctcc tgccctgccctcctgcccgccctccctcctgcctgcgcagctccttccctaggcacctct gtgctgcatcccaccagcctgagcaagacgccctctcggggcctgtgccgcactagcctc cctctcctctgtccccatagctggtttttcccaccaatcctcacctaacagttactttac aattaaactcaaagcaagctcttctcctcagcttggggcagccattggcctctgtctcgt tttgggaaaccaaggtcaggaggccgttgcagacataaatctcggcgactcggccccgtc tcctgagggtcctgctggtgaccggcctggaccttggccctacagccctggaggccgctg ctgaccagcactgaccccgacctcagagagtactcgcaggggcgctggctgcactcaaga ccctcgagattaacggtgctaaccccgtctgctcctccctcccgcagagactggggcctg gactggacatgagagccccttggtgccacagagggctgtgtcttactagaaacaacgcaa acctctccttcctcagaatagtgatgtgttcgacgttttatcaaaggccccctttctatg ttcatgttagttttgctccttctgtgtttttttctgaaccatatccatgttgctgacttt tccaaataaaggttttcactcctctaaaaaaaaaaaaaaaaaaaaa

5. Where are we now in collagen VI myopathies? • Collagen VI disorders are increasingly recognized • Likely among the most common muscular dystrophies/myopathies • Clinical spectrum expanding • Progression/prognosis are not well defined • No specific treatments • Treatments in development based on correction of abnormal mitochondrial function • Outcome measures for potential clinical studies are not well defined • How do we measure success of a particular therapy?

6. Where are we in genetics of Collagen VI • Dominant and recessive inheritance has been described for both BM and UCMD • Most mutations identified are specific to a single person/family • Variant vs. mutation is often unclear • Consistent genotype/phenotype correlations lacking

7. Collagen VI at the University of Utah • CLIA certified genetic testing has been available at the Utah Genome Center since 2006 • To date, testing has been completed almost 400 patients. • Since patient samples are sent without clinical data we do not know the clinical history of these patients • Natural history and genotype/phenotype project • Re-contacting all patients who have had genetic testing for collagen VI to collect detailed clinical data allowing correlation with the genotype data already obtained.

8. United Dystrophinopathy Project • Multi-centered natural history and genotype/phenotype study • Now >1000 participants from 7 participating centers • Children's Hospital of Philadelphia, Philadelphia, PA • University of Minnesota, Minneapolis, MN • Nationwide Children's Hospital, Columbus, OH • University of Iowa, Iowa City, Iowa • University of Utah, Salt Lake City, UT • Washington University, St. Louis, MO • University of California, Davis, Sacramento, California • Patients are seen on yearly basis • Confirmation of genetic diagnosis

9. 390 clinical samples genotyped 86 Parent/sib carrier testing 304 Full sequencing of COL6A1,2,3 39 positive 47 negative 163 patients with variant detected 141 patients with no mutation detected Of 163 with variant detected: 91 probably pathogenic, 72 unknown significance

10. Muscle Patient Genes COL6A

11. Collagen VI myopathy study at Utah • Catalog detailed clinical and genetic data in patients with Collagen VI myopathies • Clarify breadth of potential phenotypes • Detail natural history (progression over time) • Improve accuracy of genetic diagnosis and prognosis • Define genotype/phenotype relationships • Stimulate development of potential therapies • Provide a resource for investigators conducting clinical trials • Well defined cohorts • Appropriate outcome measures • Improved understanding of molecular pathogenesis • Facilitate collaboration among investigators, families, and others • Integration with CMDIR • Establishment of collaborations leaders in the field

12. Patient Recruitment • Primary recruitment from Utah Genome Center since Jan 2010 • Over 400 patients with genetic testing since 2006 with 50 enrolled thus far • Goal is to re-contact patients for whom we have completed sequencing to collect clinical data • Primary contact is through referring physician • Anticipated expansion of enrollment to include any patient with collagen VI myopathy diagnosis • Summer 2010

13. Enrollment/Participation • All patients with collagen VI myopathy phenotypes (ie. Bethlem myopathy or Ullrich CMD) are eligible to enroll • A clinic visit is not required for participation • Participants will fill out a short questionnaire detailing symptoms and physical findings • We will request records from treating physicians including results of genetic testing (if done outside UGC) and other diagnostic tests • In some cases, we may request a sample from skin or muscle biopsy if they are already in existence

14. A couple areas of interest in our lab • Mutation negative collagen VI patients • 46% patients with no identifiable mutation • Some of these with decreased collagen VI on muscle or skin biopsy • Potential explanations: • Deletion mutation not identifiable by sequencing from genomic DNA • Mutation in non-coding regulatory region • Allelic locus or secondary collagen VI defect • Non-collagen VI disorder • Defining pathogenicity (or non-pathogenicity) “variants” • 163/304 samples with sequencing of all 3 COL6A genes identified variant • 72 of these (44%) are of uncertain pathogenicity • High throughput genomics—transcriptome, exome sequencing

15. Acknowledgements • Utah Genome Center, Robert Weiss, Director • Weiss lab: Diane Dunn, Brett Duval • Kathryn Swoboda • Swoboda group: LahdanHeidarian • Collaborators • Kevin Flanigan-Nationwide Children’s • CarstenBönnemann-CHOP • Funding: • Muscular Dystrophy Association • NIH-Loan Repayment Program • Primary Children’ Foundation, CHRC Thank you to CureCMD for the opportunity to participate in this conference.