560 likes | 1.01k Views
Epigenetics. Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520. Epigenetics. Heritable changes in gene function that occur without a change in the DNA sequence How come not all the motif sites are bound by the factor? How come TF binding only regulate some of the nearby genes?.
E N D
Epigenetics Xiaole Shirley Liu STAT115, STAT215, BIO298, BIST520
Epigenetics • Heritable changes in gene function that occur without a change in the DNA sequence • How come not all the motif sites are bound by the factor? • How come TF binding only regulate some of the nearby genes?
Epigenetics • The study of heritable (transgenerational) changes in gene activity that are not caused by changes in the DNA sequence • The study of stable, long-term alterations in the transcriptional potential of a cell that are not necessarily heritable • Functionally relevant changes to the genome that do not involve a change in the nucleotide sequence
In Human • Nature vs nurture • Zygotic twins: same DNA different epigenome • North American Ice Storm of 1998
The Making of a Queen Larvae Worker Queen From Ting Wang, Wash U
Epigenetic Landscape Conrad Hal Waddington (1905–1975) Developmental biologist Paleontologist Geneticist Embryologist Philosopher Founder for systems biology
Components • DNA-methylation • Nucleosome position and histone modifications • Chromatin accessibility • Higher order chromatin interactions • Analogy
DNA Methylation Distribution in Mammalian Genomes • In human somatic cells, 60%-80% of all CpGs (~1% of total DNA bases) are methylated • Most methylation is found in “repetitive” elements • “CpG islands”, GC-rich regions that possess a high density of CpGs, remain methylation-free • The promoter regions of ~70% of genes have CpG islands From Ting Wang, Wash U
Two classes of DNA methyltransferases (DNMTs) Jones and Liang, 2009 Nature Review Genetics
Inheritance of DNA Methylation From Ting Wang, Wash U
DNA Methylation Detection • Bisulfite sequencing • Unmethyl C T • High resolution, quantitative, but expensive!
BS-seq Methylation Call • Most regions are either mostly methylated or mostly unmethylated (dichotomy) • Methylation level within a short distance is consistent ACGGGCTTACTTGCTTTCCTACGGGCTTACTTGCTTTCCTACGGGCTTACTTGCTTTCCTACGGGCTTACTTGC CGGGTTTATTTGCTTTTTTATGGGC TGGGTTTATTTGCTTTTTTATGGGC TGGGTTTATTTGCTTTCCTATGGGC CGGGCTTATTTGCTTTCCTATGGGC CGGGCTTATTTGCTTTCCTATGGGC 3/5 0/5 60% methylated 0% methylated From Ting Wang, Wash U
DNA Methylation Controls Gene Expression • Methylation at CpG islands often repress nearby gene expression • Many highly expressed genes have CpG methylation on their exons Some genes could be imprinted, so maternal and paternal copies have different DNA methylation From Ting Wang, Wash U
DNA Methylation in Cancer • Prevalent misregulation of DNA methylation in cancer: global hypomethylation and CpG island hypermethylation • Methylation variable regions in cancer
DNA Demethylation • Recently, another type of DNA methylation called hydroxyl methylation (hmC) is found • hmC is an intermediate step between mC and C. • TET family of proteins are important for DNA demethylation • Mutation in TET is linked to many cancers
Components • DNA-methylation • Nucleosome position and histone modifications • Chromatin accessibility • Higher order chromatin interactions • Analogy
Nucleosome Occupancy & Histone Modification Influence Factor Binding TF
Histone Modifications • Different modifications at different locations by different enzymes
Histone Modifications in Relation to Gene Transcription From Ting Wang, Wash U
Histone Modifications • Gene body mark: H3K36me3, H3K79me3 • Active promoter (TSS) mark: H3K4me3 • Active enhancer (TF binding) mark: H3K4me1, H3K27ac • Both enhancers and promoters: H3K4me2, H3/H4ac, H2AZ • Repressive promoter mark: H3K27me3 • Repressive mark for DNA methylation: H3K9me3
lncRNA Identification • H3K4me3 active promoters • H3K36me3 transcription elongation Guttman et al, Nat 2009
MNase digest Antibody for Nucleosome Occupancy & Histone Modification Influence Factor Binding TF
Use H3K4me2 / H3K27ac Nucleosome Dynamics to Infer TF Binding Events /ac /ac /ac /ac /ac Condition 1 Condition 2 Nucleosome Stabilization-Destabilization (NSD) Score He et al, Nat Genet, 2010; Meyer et al, Bioinfo 2011
Condition-Specific Binding, Epigenetics and Gene Expression C1 C2 • Condition-specific TF bindings are associated with epigenetic signatures • Can we use the epigenetic profile and TF motif analysis to simultaneous guess the binding of many TFs together? C1 C2 Genes TF1 TF2 TF3 Epigenetics
Identify Major TF Modules Regulating Gut Differentiation and Function • Nucleosome dynamics now applied to hematopoiesis and cancer cell reprogramming GATA6 Cdx2 Cdx2 HNF4 Metabolic and digestive genes Embryonic and organ development genes Verzi et al, Dev Cell, 2010
Components • DNA-methylation • Nucleosome position and histone modifications • Chromatin accessibility • Higher order chromatin interactions • Analogy
DNase Hypersensitive (HS) Mapping • DNase randomly cuts genome (more often in open chromatin region) • Select short fragments (two nearby cuts) to sequence • Map to active promoters and enhancers Ling et al, MCB 2010
DHS Peaks Capture Most TF Binding Sites • Motif occurrence in the DHS peaks suggest TF binding • Quantitative signal strength also suggest binding stability Thurman et al, Nat 2012
DnaseI Cleavage vs Footprint GATACA CTA TGT • Footprint occupancy score: FOS = (C + 1)/L + (C + 1)/R • Smaller FOS value better footprint, for predicting base resolution TF binding L C R
DnaseI Cleavage vs Footprint GATACA CTA TGT • Footprint occupancy score: FOS = (C + 1)/L + (C + 1)/R • Smaller FOS value better footprint, for predicting base resolution TF binding • Intrinsic DNase cutting bias could have 300-fold difference, creating fake footprints L C R CAGATA 0.004 CAGATC 0.004 … ACTTAC 1.225 ACTTGT 1.273
Using DNaseI “Footprint” to Predict TF Binding • Using base-pair resolution cleavage pattern (“footprint”) hurts TF binding prediction when it is similar to intrinsic DNaseI cutting bias
Using DNaseI “Footprint” to Predict Novel TF Motifs He et al, Nat Meth 2013
Transcription and Epigenetic Regulation • Stem cell differentiation • Aging brain • Cancer