Figure 4 The putative FLCN pathway

Sep 08, 2014

10 likes | 130 Views

Figure 4 The putative FLCN pathway. Linehan, W. M. et al. (2010) The genetic basis of kidney cancer: a metabolic disease Nat. Rev. Urol. doi:10.1038/nrurol.2010.47.

Share Presentation

Embed Code

Link

urol
genetic basis
kidney cancer
1038 nrurol
putative flcn pathway
metabolic disease nat

raanan

Download Presentation

Figure 4 The putative FLCN pathway

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Figure 4 The putative FLCN pathway Linehan, W. M. et al.(2010) The genetic basis of kidney cancer: a metabolic diseaseNat. Rev. Urol. doi:10.1038/nrurol.2010.47

Supplemental figure 4

A. B. C. D. Supplemental figure 4. Supplemental Figure S4. Kinetics of total IFN γ + (A), IL-2+ (B) and TNFa+ (C) CD4+ and IFN γ + (D) CD8+ T-cell responses in KTRs during the clinical course of BKV re-activation

163 views • 2 slides

Figure 3.21 The widely used RTK signal transduction pathway

Figure 3.21 The widely used RTK signal transduction pathway. Figure 3.22 Activation of MITF transcription factor through the binding of stem cell factor by the Kit RTK protein (Part 2). Tunicate life cycle. Part Figure II.2 Autonomous specification in the early tunicate embyro (Part 1).

969 views • 11 slides

Supplemental Figure 4

Supplemental Figure 4. a. Succinate Succinate+ADP Succinate+Oligo Succinate+FCCP. b. Succinate Succinate+ADP Succinate+Oligo Succinate+FCCP. p <0.05. p <0.05.

101 views • 1 slides

Figure 1 The nociceptive pain pathway

Figure 1 The nociceptive pain pathway. Bingham B et al. (2008) The molecular basis of pain and its clinical implications in rheumatology Nat Clin Pract Rheumatol doi:10.1038/ ncprheum0972.

1.64k views • 1 slides

Supplementary Figure 4.

Supplementary Figure 4. Supplementary Figure 4. Southern blot analysis for OsCAF1B gene in rice. Genomic DNA was isolated from rice suspension cultured cells and analyzed by Sourthern blot analysis using the OsCAF1B -specific region as probes.

113 views • 1 slides

Figure 4

Figure 4. a. b. C C N. p=0.0081. p=0.0004. p=.0457. p<0.0001. EN2. p<0.0001. p<0.0001. 55. 28. 27. 466. 251. 113. 102. 111. 140. 215. n. c. All Ca v a ll non- Ca normal only. AUC 0.844 AUC 0.908.

142 views • 1 slides

Supplemental Figure 4

Supplemental Figure 4.

73 views • 1 slides

Supplementary Figure 4

Supplementary Figure 4. Experimental model GSH content (nmol/mg protein). a. Control 22,7 ± 2,5 Vector 21,7 ± 2,5 pUSP2a WT 29,3 ± 1,5 a pUSP2a MUT 22,3 ± 5,7 siControl 18,7 ± 0,6 siUSP2a 15,0 ± 2,0 b a P <0,05 pUSP2a WT vs Vector b P <0,05 siControl vs siUSP2a. LNCaP. b.

75 views • 1 slides

Supplementary Figure 4

A. - - + + - - + +. - - - - + + + +. - + - + - + - +. DCB. VPA. LC3-I. TRAIL. LC3-II. b -actin. B. -. CQ, 25 μ M. 8.5. 0.9. 1.4. 0.4. -. 14.1. 76.5. 4.8. 93.4. 7.1. 0.9. 2.5. 0.2.

67 views • 1 slides

Figure 4

Figure 4.

99 views • 1 slides

Pathway to the Cross (part 4)

Pathway to the Cross (part 4). Christâ€™s Public Presentation. The Triumphal Entry. Matthew 21:1-11. Matthew 21:1-11 (ESV).

313 views • 19 slides

Supplemental Figure 4

Supplemental Figure 4. a. 1000, 2000, 4000, 8000 cells/well into 96 well dish. 10, 20, 40, 80 cells/well into 96 well dish. R.L.U. measurement. R.L.U. measurement. CellTiter-Glo. CellTiter-Glo. 10% FBS DMEM. 10% FBS DMEM. 7 days. 6 hr. co llagen concentration.

101 views • 1 slides

Figure S3 . Putative integration sites for the lvh –containing mobile element

tRNA-Pro 1267202 CGGGGCGTAGCGCAGCCTGGTAGCGTACTAGCATGGGGTGCTAGTGGTCGAAGGTTCAAATCCTTCCGTCCCGACCA 1267126 repeat-1 1222166 TTTGAAATTGAATGAAATGGGTTGTTATTAGCATGGGGTGCTAGTGGTCGAAGGTTCAAATCCTTCCGTCCCGACCA 1222090

92 views • 1 slides

Figure 1 Putative evolution of OA phenotypes and therapies

Figure 1 Putative evolution of OA phenotypes and therapies. Conaghan, P. G . (2012) Parallel evolution of OA phenotypes and therapies Nat. Rev. Rheumatol. doi:10.1038/nrrheum.2012.225.

114 views • 1 slides

Supplementary Figure 4

Supplementary Figure 4. A. B. Ctl sip300. Ctl siPCAF. p300. PCAF. ERCC1. ERCC1. Actin. Actin. Cisp (2h). Cisp (2h).

101 views • 1 slides

Putative pheoviral replication

HGT. H. 2 OBPs. Polydnavirus. replication. Organism. E. Mimivirus. 2 OBPs. A. Ancestral NCLDV. 2 OBPs. 1 OBP. F. Giant DNA virus. Herpes virus lineage. D. Herpes virus, Asfarvirus. HGT. Integration of one copy of the viral genome. C. 2 OBPs. Primitive eukaryotic cell.

138 views • 1 slides

Supplementary Figure 4

Supplementary Figure 4.

80 views • 1 slides

Supplemental figure 4

Supplemental figure 4.

96 views • 1 slides

Figure 4

Figure 4. Figure 5. A. B. B2M/CD73. 100bp. Water. Adipo. P0. AD7. 100bp. 1Kbp. CD73. B2M. B2M/FAB4. 100bp. Water. Adipo. P0. AD7. 100bp. 1Kbp. B2M. FABP4. Figure 6.

119 views • 3 slides

Supplementary Figure 4

Supplementary Figure 4. PELP1 TG +Par. PELP1 TG. WT. A. DiK9me2. B. C. PELP1 TG. PELP1 TG + Par. PELP1 TG. PELP1 TG + Par. Cyclin D1. Ser991 PELP1.

88 views • 1 slides

Suppl. Figure 4

Amino acid Observed Mw(expt) Mw(calc) ppm Score Sequence position m/z Da Da 25 - 33 546.7761 1091.5376 1091.5169 19 35 -.DLIDEICSK.T 25 - 37 512.6048 1534.7927 1534.7549 25 21 -.DLIDEICSKTDVK.K

116 views • 1 slides

More Related