Isaiah 33:22

1. Isaiah 33:22 22 For the Lord is our judge, the Lord is our lawgiver, the Lord is our king; he will save us.

2. ReplicationandRecombination Timothy G. Standish, Ph. D.

3. The Information Catch-22 “With only poor copying fidelity, a primitive system could carry little genetic information without L [the mutation rate] becoming unbearably large, and how a primitive system could then improve its fidelity and also evolve into a sexual system with crossover beggars the imagination.” Hoyle F., "Mathematics of Evolution", [1987], Acorn Enterprises: Memphis TN, 1999, p 20

4. Conservative - Old double-stranded DNA serves as a template for two new strands which then join together, giving two old strands together and two new strands together Semi-conservative - Old strands serve as templates for new strands resulting in double-stranded DNA made of both old and new strands Old New Old New Old Old Old New + + Old + New Old + New Old + New Old + New Old Dispersive - In which sections of the old strands are dispersed in the new strands + + or DNA Replication:How We Know • There are three ways in which DNA could be replicated:

5. OH NH2 O P HO O N N N N H OH The Meselson-Stahl Experiment • The Meselson-Stahl experiment demonstrated that replication is semiconservative • This experiment took advantage of the fact that nucleotide bases contain nitrogen • Thus DNA contains nitrogen • The most common form of nitrogen is N14 with 7 protons and 7 neutrons • N15 is called “heavy nitrogen” as it has 8 neutrons thus increasing its mass by 1 atomic mass unit

6. Transfer to normal N14 media Conservative model prediction Dispersive model prediction Semiconservative model prediction After 20 min. (1 replication) transfer DNA to centrifuge tube and centrifuge Bacteria grown in N15 media for several replications The Meselson-Stahl Experiment X The conservative and dispersive models make predictions that do not come true thus, buy deduction, the semiconservative model must be true. Prediction after 2 or more replications X X

7. Stages of Replication • Replication can be divided into three stages: • Initiation - When DNA is initially split into two strands and polymerization of new DNA is started • Elongation - When DNA is polymerized • Termination - When the new strands of DNA are completed and some finishing touches may be put on the DNA • Both elongation and termination may involve proofreading of the DNA ensuring that mutations are not incorporated into newly formed DNA strands

8. Tools of Replication • Enzymes are the tools of replication: • DNA Polymerase - Matches the correct nucleotides then joins adjacent nucleotides to each other • Primase - Provides an RNA primer to start polymerization • Ligase - Joins adjacent DNA strands together (fixes “nicks”)

9. More Tools of Replication • Helicase - Unwinds the DNA and melts it • Single-Strand Binding Proteins - Keep the DNA single stranded after it has been melted by helicase • Gyrase - A topisomerase that relieves torsional strain in the DNA molecule • Telomerase - Finishes off the ends of DNA strands

10. Initiation • Initiation starts at specific DNA sequences called origins (Ori C = origin in E. coli chromosomes) • Long linear chromosomes have many origins • First the origin melts (splits into two single strands of DNA) • Next primers are added • Finally DNA polymerase recognizes the primers and starts to polymerize DNA 5’ to 3’ away from the primers

11. Origin of Replication 5’ 3’ 3’ 5’ Replication eye or replication bubble 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 3’ 5’ Initiation - Forming the Replication Eye Or Bubble

12. Origins of Replication 5’ 3’ 5’ 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ Large Linear Chromosomes Have Many Origins Of Replication

13. 3’ 5’ 5’ 3’ 3’ 5’ 3’ Primase - Makes RNA primers 5’ Single-strand binding proteins - Prevent DNA from re-anealing Lagging Strand 5’ 5’ 3’ 5’ RNA Primers DNA Polymerase 5’ 3’ Helicase - Melts DNA Leading Strand 5’ 3’ Extension - The Replication Fork Okazaki fragment

14. DNA Pol. 5’ 3’ 3’ 5’ Okazaki Fragment RNA Primer DNA Pol. 5’ 3’ 3’ 5’ RNA Primer RNA and DNA Fragments 5’ 3’ 3’ 5’ RNA Primer Nick Extension - Okazaki Fragments DNA Polymerase has 5’ to 3’ exonuclease activity. When it sees an RNA/DNA hybrid, it chops out the RNA and some DNA in the 5’ to 3’ direction. DNA Polymerase falls off leaving a nick. Ligase The nick is removed when DNA ligase joins (ligates) the DNA fragments.

15. Helicase The Role of DNA Gyrase

16. Supercoiled DNA Helicase The Role of DNA Gyrase Gyrase

17. The Role of DNA Gyrase Gyrase

18. The Role of DNA Gyrase Gyrase

19. The Role of DNA Gyrase Gyrase

20. The Role of DNA Gyrase Gyrase

21. The Role of DNA Gyrase Gyrase

22. The Role of DNA Gyrase Gyrase

23. The Role of DNA Gyrase Gyrase

24. The Role of DNA Gyrase Gyrase

25. The Role of DNA Gyrase Gyrase

26. E. coli has three identified DNA polymerases, each of which has significantly different physical characteristics and roles in the cell Polymerase I II III 5’- 3’ Polymerization Yes Yes Yes 3’-5’ Exonuclease Yes Yes Yes 5’-3’ Exonuclease Yes No No Molecules/cell 400 ? 15 E. coli DNA Polymerases Major function Proofreading/ Removal of RNA primers Repair of damaged DNA Replication polymerization 10 subunits 600,000 daltons

27. DNA Pol. 5’ 3’ 5’ DNA Pol. 5’ 3’ 5’ 5’ DNA Pol. 5’ 3’ MutationWhen Mistakes Are Made Mismatch 3’ to 5’ Exonuclease activity

28. 3’ 5’ 3’ 5’ 5’ 5’ 3’ 3’ MutationExcision Repair Endo- Nuclease Thimine Dimer

29. 3’ 5’ 3’ 3’ 5’ 5’ Nicks 5’ 5’ 5’ 3’ 3’ 3’ MutationExcision Repair Endo- Nuclease DNA Pol.

30. 3’ 5’ 3’ 5’ DNA Pol. 3’ 5’ 5’ 5’ 5’ 3’ 3’ 3’ MutationExcision Repair Endo- Nuclease

31. 3’ 5’ 3’ 5’ Nicks 3’ 5’ 5’ 5’ 5’ 3’ 3’ 3’ Ligase Nick MutationExcision Repair Endo- Nuclease Ligase DNA Pol.

32. Telomere 5’ 3’ 3’ 5’ Degradation of RNA primer at the 5’ end 5’ 3’ 3’ 5’ Next replication 5’ 3’ + 3’ 5’ 3’ 5’ 5’ 3’ Telomerase At the end of linear chromosomes the lagging strand can’t be completed as the last primer is removed and no 3’ hydroxyl group is available for DNA polymerase to extend from

33. Telomerase 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG AACCCCAAC RNA Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length GGGTTG

34. Telomerase 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG AACCCCAAC RNA Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length GGGTTG GGGTTG

35. Telomerase 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG AACCCCAAC RNA Telomerase Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length GGGTTG GGGTTG GGGTTG

36. O O H H N N 5’GACCGAGCCTCTTGGGTTGGGGTTGGGGTTGGGGTTG N N 3’CTGGCTCGG H H N N N N Guanine N N H H Guanine Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing

37. Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing DNA Pol. 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG GGGGTTG T T 3’GTTGGGG 3’CTGGCTCGG

38. Endo- nuclease Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing DNA Pol. 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG T T AGAACCCAACCCGTTGGGG 3’CTGGCTCGG

39. Endo- nuclease GTTGGGG T T GTTGGGG Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGG AGAACCCAACCC 3’CTGGCTCGG

40. The Current Eukaryotic Recombination Model Homologous chromosomes Meiosis Prophase I

41. Double strand break The Current Eukaryotic Recombination Model Exo- nuclease

42. The Current Eukaryotic Recombination Model Exo- nuclease

43. The Current Eukaryotic Recombination Model Exo- nuclease

44. The Current Eukaryotic Recombination Model Exo- nuclease

45. DNA Polymerase The Current Eukaryotic Recombination Model

46. DNA Polymerase The Current Eukaryotic Recombination Model

47. DNA Polymerase The Current Eukaryotic Recombination Model

48. DNA Polymerase The Current Eukaryotic Recombination Model

49. The Current Eukaryotic Recombination Model

50. Holliday Structure