Transcription and Translation

1. Transcription and Translation Building Proteins

2. RNA Review • RNA is just like DNA, except that it is only one strand, instead of two. • The other difference is that RNA replaces all of the THYMINE with URACIL. • So, C still pairs with G. • Cytosine with Gaunine • But now, A pairs with U. • Adenine with Uracil

3. RNA Review • RNA is like a photocopy of the DNA. It is what actually gets sent out to the ribosomes for building proteins. • The CEO (the nucleus) does not want to let the DNA out of his reach. It is way way too long and the CEO needs it to replicate! • It is needed to replicate new DNA, if the cell ever needs to make a new cell or reproduce. Plus, it contains instructions for everything • So, the CEO (nucleus) decides to make a photocopy of the DNA to send out to the WORKERS (ribosomes). • The RNA is specific to one protein. For example, it could just build protein, or hemoglobin. • This is the RNA! We call it mRNA for MESSENGER RNA!

4. Transcription Review • mRNA is created through the process of TRANSCRIPTION! • Just like DNA replication, transcription occurs by splitting the DNA apart. However, in transcription it is only temporary. • Then, the mRNA strand pairs up with one strand of DNA and base pairs come together. • The only difference is mRNA pairs A with U (it still pairs T with A). • Finally, the DNA molecule comes back together and the mRNA head off for the ribosomes (workers) to build proteins.

5. Transcription and Translation • Transcription is the process that creates a photocopy of the instructions. • The instructions are the DNA. The photocopy is the mRNA • Translation is the process in which the workers read the photocopy to create proteins. • The workers are the ribosomes • Let’s read a story about it… • But first, what is an analogy? • A comparison between two things

6. Translation • Translation starts with the mRNA leaving the nucleus for the cytoplasm • A ribosome grabs hold of a strand of mRNA and starts to read it, three letters at a time. • Each 3 letter section of mRNA is called a CODON. • Each codon represents an amino acid that will be added to the chain.

7. What is a codon? • Remember, a GENE is like a sentence in the genetic code • ACGUUGCCAAGCAAUCG (or HASBROWNHAIR) • Then, A CODON is like a word • Each codon tells the ribosome which AMINO ACID to use • A codon is 3 letters • Ex. CAG means glutamine • Some codons mean “Start” or “Stop” • A BASE is like a letter • A, U, G, C

8. Building Proteins • As the ribosome reads the mRNA, transfer molecules (tRNA) fetch amino acids and bring them back to the ribosome. • The transfer molecules line up with the correct codon and add their amino acid to the growing chain. • Eventually, the rib0some reads “stop” and the protein chain is complete! Let’s try translating some proteins!

10. Let’s see it in action… • http://www.youtube.com/watch?v=8dsTvBaUMvw&feature=channel • http://learn.genetics.utah.edu/content/begin/dna/transcribe/

11. Let’s Try it! • TRANSCRIPTION: First, translate the DNA into mRNA. • DNA: TAAGCTACCTTCGCATGGCATGCATC • mRNA: AUUCGAUGGAAGCGUACCGUACGUAG • TRANSLATION: Next, read the mRNA from left to right, looking for the “start” codon AUG. • TRANSLATION: Now, read one codon at a time and use your codon chart to find the correct AMINO ACID • TRANSLATION: Once you get to the stop codon, you’re chain of amino acids is complete and you have created a protein!

12. Now, try it on your own.

13. Exit Slip • 1) What is a codon? • 2) Describe the process of translation in your own words: