1 / 17

Transcription and Translation

Transcription and Translation. Protein Structure. Made up of amino acids Polypeptide - string of amino acids bonded together (peptide bonds) Enzymes are proteins 20 amino acids are arranged in different orders to make a variety of proteins Assembled on a ribosome.

tudor
Download Presentation

Transcription and Translation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Transcription and Translation

  2. Protein Structure • Made up of amino acids • Polypeptide- string of amino acids bonded together (peptide bonds) • Enzymes are proteins • 20 amino acids are arranged in different orders to make a variety of proteins • Assembled on a ribosome

  3. Transcription and Translation: An Overview Transcription Translation

  4. DNA Double stranded Deoxyribose sugar Bases: C,G A,T RNA Single stranded Ribose sugar Bases: C,G,A,U RNA vs. DNA

  5. Transcription • mRNA from DNA • mRNA’s bases are complementary to that of DNA • C-G • A-U • NOTICE: Uracil replaces Thymine • Occurs in nucleus

  6. Major players in transcription • RNA polymerase- • Unwind DNA sequence • mRNA is synthesized using 1 strand of DNA (template strand) • Long chain of mRNA nucleotides are createdbases complementary to the DNA template

  7. TRANSCRIPTION ACGATACCCTGACGAGCGTTAGCTATCG GGG ACU UGC UAU **Each group of 3 bases of mRNA (see colors above) are called a codons

  8. Transcription • After transcription, mRNA- now has the information to carry out protein synthesis

  9. Transcription is done…what now? Now we have mRNA transcribed from the cell’s DNA. It leaves the nucleus through a nuclear pore into the cytoplasm Once in the cytoplasm, it finds a ribosome where translation can begin. The mRNA code has to be read now so a protein can be “assembled”

  10. Translation • Second stage of protein production • mRNA is on a ribosome and “read” in groups of three bases (a codon) • tRNA brings amino acids to the ribosome

  11. tRNA • Transfer RNA (tRNA) is bound to one amino acid on one end • tRNAanticodon complements mRNA codon. • If they do not complement, the tRNA’samino acid will not be a part of the protein!

  12. Ribosome Reads the DNA code • Every mRNA codon of bases encode for an amino acid (see chart handout of Amino Acids) • There is a Start codon(AUG) telling the ribosome where to start translation and a STOP codon ending protein synthesis

  13. ACGATACCCTGACGAGCGTTAGCTATCG UGC GGG ACUG UAU

  14. After All Is Said and Done…. • The amino acid sequence forms a protein • Leads to a particular function and phenotype (trait) in an organism • Proteins can be structural (forming a part of cell materials) • Proteins can be functional (hormones, enzymes, biochemicals)

  15. Protein

  16. Protein Shapes Vary Amylase – an enzyme in your mouth Hemoglobin on Red blood cells

  17. Transcription Process by which genetic information encoded in DNA is copied onto messenger RNA Occurs in the nucleus DNA mRNA Translation Process by which information encoded in mRNA is used to assemble a protein at a ribosome Occurs on a Ribosome mRNA protein as tRNA brings in its Amino Acid Transcription vs. Translation Review

More Related