1 / 18

Genome Sequencing in the Legumes

Genome Sequencing in the Legumes. Le et al. 2007. ~14 MY. ~45 MY. Phylogeny. Major sequencing efforts Minor sequencing efforts. Zhu et al. 2005. Papilionoideae in GenBank. Types of sequencing. Physical map --> Sequence map Traditional--human & Arabidopsis Sequence map --> Physical map

sela
Download Presentation

Genome Sequencing in the Legumes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Genome Sequencing in the Legumes Le et al. 2007

  2. ~14 MY ~45 MY Phylogeny • Major sequencing efforts • Minor sequencing efforts

  3. Zhu et al. 2005

  4. Papilionoideae in GenBank

  5. Types of sequencing • Physical map --> Sequence map • Traditional--human & Arabidopsis • Sequence map --> Physical map • Drosophila • Incomplete sequence map • With or without physical information

  6. Genome 150 kb fragments Physical to Sequence (rice, Arabidopsis, human) ? ..actggtcgtaatgtagttgccctcagfgttagtaattttattgtagtatgatgt.. BAC library

  7. fingerprint Integrate genetic physical map

  8. Minimum Tiling Path Genetic map Map-based Genome Sequencing actggagtggatgaactgactaaactgtaactgtacgatcgtttagctacggcggcgatcgatcgggtcagcacgtagctagctgacgtgggctagctaattatacgatcggagatcgatcgtaatcggatcgatcgcgcggcatctacgatcgatcgtagctagtc Physical map Chromosome

  9. Soybean chromosomes scaffold contig Shotgun sequencing • Lots of contigs/scaffolds • Not anchored to genetic map

  10. shotgun sequence Physical map Genetic map Shotgun Genome Sequencing Chromosome

  11. Outcomes • Map-based approach • Highly ordered, clone-based, genetically integrated, contiguous sequence (gold standard) • Slower, costly • Shotgun approach • Initially disordered, though can be genetically integrated • May or may not have underlying physical map • May have assembly problems • Fast and less expensive

  12. Prerequisites • Understand genome structure • Neopolyploidy? • Repeat content? • Repeat distribution? • Comparisons to related genomes. How valuable will they be?

  13. Leveraging Genomes • Understand and introgress diversity • Marker development for selection and gene cloning • Basic questions: evolution, genome structure

  14. Genus Oryza A - O. rufipogon B - O. nivara C - O. glaberrima

  15. How to deal with incompletely sequenced genomes • Genetic and physical maps/information are imperative • Leverage related genomes to aid in assembly • Target finishing to regions of interest • Genic/QTLs/anchored scaffolds… • Low coverage sequencing of MTP or entire BAC library

  16. Doyle and Luckow 2004

More Related