1 / 36

DNA and Protein Synthesis Notes

DNA and Protein Synthesis Notes. November 17, 2011. A. Function of Nucleic Acids. Control the processes of heredity by which cells and organisms reproduce proteins. B. Types of Nucleic Acids . DNA: Deoxyribonucleic Acid RNA: Ribonucleic Acid. C. Structure of Nucleic Acids.

ursula
Download Presentation

DNA and Protein Synthesis Notes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA and Protein Synthesis Notes November 17, 2011

  2. A. Function of Nucleic Acids • Control the processes of heredity by which cells and organisms reproduce proteins.

  3. B. Types of Nucleic Acids • DNA: Deoxyribonucleic Acid • RNA: Ribonucleic Acid

  4. C. Structure of Nucleic Acids • Made up of a chain of Nucleotides that contain • Phosphate backbone • Sugar • Nitrogen base • Guanine • Cytosine • Adenine • Thymine (Found only in DNA) • Uracil (Found only in RNA)

  5. DNA SUGAR Phosphate

  6. D. DNA vs. RNA • Sugar is Ribose • Has nitrogen base Uracil instead of Thymine • Also contains the other 3 bases • Only single stranded

  7. II. Protein Synthesis • It’s a process • DNA -> RNA -> Amino Acids (Protein)

  8. Three processes in this unit… • Replication (DNA DNA) *REPLICATION IS NOT ON THE TEST BUT PAY ATTENTION ANYWAY…FOR KNOWLEDGE SAKE…COMES UP AGAIN IN MITOSIS…YOU’LL LEARN DETAILS IN AP BIO 2. Transcription (DNA mRNA) 3. Translation (RNA Protein)

  9. A. DNA Replication • Occurs in the nucleus prior to any cell division • Enzyme is used to “unzip” or “unwind” the DNA • Forms a bubble at the origin site

  10. DNA replication- replication bubbles

  11. DNA replication- leading/lagging strands

  12. DNA replication

  13. DNA Replication (cont.) • Another enzyme is used to build a complementary strand of DNA from the template piece of original DNA • Nitrogenous bases pair up • A – T • C - G • As a result, you create two identical strands of DNA

  14. Let’s Practice • Replicate the following strand of DNA using the correct nitrogenous bases: ATCGGCTATTAGGCATATCCGACGGTC TAGCCGATAATCCGTATAGGCTGCCAG

  15. B. Transcription • DNA strand unzips • The bonds between the nitrogen bases are broken • Initiated by RNA polymerase (enzyme) binding to promoter site on DNA • A single strand of mRNA (messenger RNA) is made • Pair up the bases • A  U • T  A • C  G • G  C • mRNA then travels from nucleus to cytoplasm

  16. Transcription

  17. Where in the cell does transcription take place? • Cytoplasm • Mitochondria • Nucleus • Golgi Body • Vacuole

  18. Any given segment of DNA has directions that make unique what? • Glucose • Proteins • Lipids • Blood cells

  19. If a DNA strand has the following sequence of base pairs – A C T G G T C C A A , then the mRNA strand would have what sequence? • T G A C C A G G T T • A C T G G T C C A A • T G U C C U G G T T • U G A C C A G G U U

  20. a. Why is mRNA called messenger RNA? • Because it carries the directions to make a protein to the ribosome like a message

  21. 4. Types of RNA • mRNA- messenger • Brings message from nucleus to ribosomes in cytoplasm • rRNA- ribosomal • Make up a ribosome • tRNA- transfer • “transfers” amino acids from the cytoplasm to the ribosome to be added to the chain

  22. The difference between RNA and DNA is what? • The phosphates • The sugars • The nitrogen bases • The way the monomer units bond

  23. mRNA is synthesized in the nucleus and travels to the cytoplasm to meet up with which organelle? • Mitochondria • Ribosome • Golgi Body • Lysosome • Nucleus

  24. C. Translation • mRNA meets up with a ribosome…why?? • Function of ribosome is to be site for protein synthesis • tRNA molecules bring amino acids to ribosomes • An mRNA codon will pair with a tRNA anticodon • Codon: 3 Nitrogen base sequence in mRNA that specifies a specific amino acid • Anticodon: 3 Nitrogen base sequence in tRNA

  25. Translation (cont.) • As tRNA’s are added, amino acids are bonded together and will be released as a fully functional protein.

  26. How do you know what amino acids make up a particular protein? • We use an mRNA codon chart

  27. Where in the cell does transcription, the first part of protein synthesis, take place? • Mitochondria • Nucleus • Ribosomes • Cytoplasm

  28. DNA has the directions to make what? • Glucose • Nucleotides • Proteins • Monosaccharides

  29. After a strand of mRNA is made where does it go? • Ribosome • Mitochondria • Lysosome • Vacuole

  30. Where in the cell does translation, the second part of protein synthesis, take place? • Mitochondria • Nucleus • Golgi body • Cytoplasm

  31. Molecules called tRNA’s are floating around the cytoplasm carrying what? • mRNA’s • Glucose • DNA • Nucleotides • Amino Acids

  32. An mRNA codon is made up of how many nitrogen bases? • 1 • 3 • 6 • 24

  33. Using your mRNA codon chart, what amino acid would a ribosome call for if the codon was A A C ? • Phenylalanine • Glutamine • Asparagine • Lysine • Tyrosine

  34. What protein would be synthesized from the following mRNA strand?A C U U U C G A A U A C • Threonine – phenylalanine – glutamate – tyrosine • Phenylalanine – leucine – methionine – valine • Tyrosine – glutamate – phenylalanine – threonine • Lysine – cysteine – arginine – histidine

  35. What protein would be synthesized from the following DNA segment?T A A G T A C G C T A G • Isoleucine – alanine – histidine – alanine • Isoleucine – histidine – alanine – isoleucine • Phenylalanine – leucine – valine – arginine • Isoleucine – leucine – threonine – lysine

More Related