New Core Curriculum

1. New Core Curriculum Foundations of Scientific Process Molecular Genetics & Gene Function

2. New Core Curriculum Foundations of Scientific Process Review Concepts covered so far: • Chromosomes • Genome • Genes • Central Dogma of Molecular Biology • DNA, RNA, proteins • Hershey-Chase experiment • Mendel’s laws of heredity • Alleles • Heterozygous vs. homozygous

3. Regulation: DNA switched on Transcription: DNA mRNA Translation: mRNA protein

5. Most DNA sequences are transcribed, but only few RNAs are translated to proteins . . Human Genome 100% transcribed Mattick, J., Human Molecular Genetics, 2006, Vol. 15, Review Issue 1 transcribed, both strands Messenger RNAs ~ 2%

6. Meaning of a genetic code Proteins The structure of DNA: variable sequence (string) built of 20 amino acids (building blocks) What Is A Virus?: Genetics Review strings of amino acids fold up into particular shape Shape governs the Function (Meaning)

7. The Central Dogma of Molecular Biology: 1) DNA encodes RNA 2) RNA encodes Proteins 3) Proteins encode shape/function DNA  RNA  Protein • Genetic information (the MEANING) is encoded in the SEQUENCE of basis along the DNA strand; • DNA is not a direct template for protein synthesis;

8. The Codon Code Triplets of RNA bases translate to particular amino acids. Triples are called Codons.

9. Codons Codons are three-base strings, so the number of possible codons are theoretically 4·4·4 = 64 There are 20 amino acids This includes the 1 START codon (Methionine)‏ The 3 STOP codons don't code for amino acids What is the biological significance of the extensive redundancy of the genetic code ???

10. DNA  RNA  Protein The Central Dogma of Molecular Biology . . . Lys-Ala-Phe-Tyr-Ala-Phe-Lys . . . . . . AAAGCUUUUUAUGCGUUCAAG . . . . . . AAAGCTTTTTATGCGTTCAAG . . .

11. DNA  RNA  Protein The Central Dogma of Molecular Biology Lys Lys Ala Phe Tyr Ala Phe

12. DNA  RNA  Protein The Central Dogma of Molecular Biology The essential amino acids are isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine. These amino acids are not produced by the body and must be obtained through protein-rich foods like beef, poultry, fish, eggs, and dairy products, or through healthy supplementation.

13. Real Genes: Globin • atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc • atggtgcatctgactcctgaggagaagtctgccgttactgccctgtgg • ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg • ctggtggtctacccttggacccagaggttctttgagtcctttggggat • ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat • ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac • aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag • ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc • tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag • gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac • aagtatcactaagctcgctttcttgctgtccaatttctattaaaggtt • cctttgttccctaagtccaactactaaactgggggatattatgaaggg • ccttgagcatctggattctgcctaataaaaaacatttattttcattgc find a reading frame

14. Real Genes: Globin • atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc • ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg • ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg • ctggtggtctacccttggacccagaggttctttgagtcctttggggat • ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat • ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac • aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag • ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc • tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag • gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac • aagtatcactaagctcgctttcttgctgtccaatttctattaaaggtt • cctttgttccctaagtccaactactaaactgggggatattatgaaggg • ccttgagcatctggattctgcctaataaaaaacatttattttcattgc START of globin

15. STOP of globin • atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc • ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg • ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg • ctggtggtctacccttggacccagaggttctttgagtcctttggggat • ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat • ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac • aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag • ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc • tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag • gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac • aagtatcacTAAgctcgctttcttgctgtccaatttctattaaaggtt • cctttgttccctaagtccaactactaaactgggggatattatgaaggg • ccttgagcatctggattctgcctaataaaaaacatttattttcattgc

16. Real Genes: Globin • atttgcttctgacacaactgtgttcactagcaacctcaaacagacacc • ATGgtgcatctgactcctgaggagaagtctgccgttactgccctgtgg • ggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggctg • ctggtggtctacccttggacccagaggttctttgagtcctttggggat • ctgtccactcctgatgctgttatgggcaaccctaaggtgaaggctcat • ggcaagaaagtgctcggtgcctttagtgatggcctggctcacctggac • aacctcaagggcacctttgccacactgagtgagctgcactgtgacaag • ctgcacgtggatcctgagaacttcaggctcctgggcaacgtgctggtc • tgtgtgctggcccatcactttggcaaagaattcaccccaccagtgcag • gctgcctatcagaaagtggtggctggtgtggctaatgccctggcccac • aagtatcacTAAgctcgctttcttgctgtccaatttctattaaaggtt • cctttgttccctaagtccaactactaaactgggggatattatgaaggg • ccttgagcatctggattctgcctaataaaaaacatttattttcattgc

17. Activity: Sickle cell anemia

18. Chemical: Molecules that encode hereditary information are complex, yet built out of the same atomic set: in particular C, H, O, N, P, and S. Meaningful: Sequences or strings of bases encode meaningful information (govern structure & function of proteins).

19. Improbable: Likelihood of 2 DNA sequences being equal by chance is exceedingly small. Historical: If you took at two people and compare a small stretch of their DNA, the chance that that small stretch agrees in all but one base pair is extraordinarily tiny if due to pure chance. It is far more likely that the correct explanation should be that all humans are related by some sort of process of inheritance. Inheritance implies ancestry, which in turn implies history. Humans share ~99.8 % of DNA with one another, ~98% of DNA with chimpanzees (our closest living relatives), and some fraction of DNA with all life on Earth.

21. Probability: one way of quantifying what outcomes are liable to be observed Probability P = (number of outcomes of interest) / (number of possible outcomes) Always a number between zero and one P(A OR B OR C) = P(A) + P(B) + P(C) P(A AND B AND C) = P(A) x P(B) x P(C)

22. What is a virus? DNA or RNA molecule carrying virus’ genetic code Encapsulated into protective protein shell (capsid) Ex: HIV is a strand of RNA capable of transferring its information “backwards” into the cell’s DNA. New Central Dogma of Molecular Biology: Viruses generally cannot self-replicate So they hijack the cell’s machinery DNA  RNA  Protein

23. Vaccines against Viral Infections Potential Problem: The vaccine version of the virus reverts to a virulent form. QUESTION: Suppose the chance of a base mutating is 20%, and chance to mutate back to original base is 1/3. What is the chance that base in a modified virus will revert back to what it was originally? QUESTION: Some poliovirus vaccines involves 5 effective mutations that weaken the virus. Imagine that the vaccine is administered to 5,000,000 people. How many people are liable to be infected by harmful polio that originates from a reversion of the vaccine?