1 / 28

Métodos Heurísticos

Métodos Heurísticos. Ventajas : Más rápido. Desventajas : Sub-óptimo. Las más conocidas. FAST : Lipman, Pearson (1985). BLAST ( B asic L ocal A lignment S earch T ool ): Altschul et al. (1990). FAST. FASTP (proteínas) FASTN (ADN) FASTA (proteínas y ADN)

chesna
Download Presentation

Métodos Heurísticos

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Métodos Heurísticos Ventajas: Más rápido Desventajas: Sub-óptimo

  2. Las más conocidas FAST: Lipman, Pearson (1985) BLAST (BasicLocalAlignmentSearchTool): Altschul et al. (1990)

  3. FAST • FASTP (proteínas) • FASTN (ADN) • FASTA (proteínas y ADN) • TFASTA (una proteína contra una base de datos de ADN) • LFASTA (devuelve más de un alineamiento local)

  4. Algoritmo FASTP • Secuencias s y t • |s| = m, |t| = n • ktup (1 ó 2 para proteínas) • Tabla de búsqueda (lookup table, ej: hash) • Vector indexado por offsets e inicializado en 0.

  5. Ejemplo (pág. 87) s = HARFYAAQIVL t = VDMAAQIA s = t =

  6. Tabla de búsqueda s =

  7. s = t = Vector de Offsets t = offsets

  8. t = offsets Vector de offsets:

  9. Scoring • Se unen aquellas k-tuplas que están en la misma diagonal no muy lejos entre sí formando regiones. • Se le da un puntaje a cada región dependiendo de los match y mismatch de cada uno. • Las 5 mejores regiones se les da un nuevo puntaje utilizando una matriz de sustitución.

  10. Matrices de Sustitución • La elección puede influir fuertemente en el resultado del análisis. • Representan una teoría particular de evolución. • Ejemplos: • PAM (Point Accepted Mutation) – PAM1, PAM 250 • BLOSUM (BLOcks SUbstitution Matrix) – BLOSUM62

  11. BLOSUM62 A R N D C Q E G H I L K M F P S T W Y V B Z X * A 4 -1 -2 -2 0 -1 -1 0 -2 -1 -1 -1 -1 -2 -1 1 0 -3 -2 0 -2 -1 0 -4 R -1 5 0 -2 -3 1 0 -2 0 -3 -2 2 -1 -3 -2 -1 -1 -3 -2 -3 -1 0 -1 -4 N -2 0 6 1 -3 0 0 0 1 -3 -3 0 -2 -3 -2 1 0 -4 -2 -3 3 0 -1 -4 D -2 -2 1 6 -3 0 2 -1 -1 -3 -4 -1 -3 -3 -1 0 -1 -4 -3 -3 4 1 -1 -4 C 0 -3 -3 -3 9 -3 -4 -3 -3 -1 -1 -3 -1 -2 -3 -1 -1 -2 -2 -1 -3 -3 -2 -4 Q -1 1 0 0 -3 5 2 -2 0 -3 -2 1 0 -3 -1 0 -1 -2 -1 -2 0 3 -1 -4 E -1 0 0 2 -4 2 5 -2 0 -3 -3 1 -2 -3 -1 0 -1 -3 -2 -2 1 4 -1 -4 G 0 -2 0 -1 -3 -2 -2 6 -2 -4 -4 -2 -3 -3 -2 0 -2 -2 -3 -3 -1 -2 -1 -4 H -2 0 1 -1 -3 0 0 -2 8 -3 -3 -1 -2 -1 -2 -1 -2 -2 2 -3 0 0 -1 -4 I -1 -3 -3 -3 -1 -3 -3 -4 -3 4 2 -3 1 0 -3 -2 -1 -3 -1 3 -3 -3 -1 -4 L -1 -2 -3 -4 -1 -2 -3 -4 -3 2 4 -2 2 0 -3 -2 -1 -2 -1 1 -4 -3 -1 -4 K -1 2 0 -1 -3 1 1 -2 -1 -3 -2 5 -1 -3 -1 0 -1 -3 -2 -2 0 1 -1 -4 M -1 -1 -2 -3 -1 0 -2 -3 -2 1 2 -1 5 0 -2 -1 -1 -1 -1 1 -3 -1 -1 -4 F -2 -3 -3 -3 -2 -3 -3 -3 -1 0 0 -3 0 6 -4 -2 -2 1 3 -1 -3 -3 -1 -4 ...

  12. Continuado... • El mejor de estos puntajes es utilizado como el score inicial (initial score). • Para las secuencias con los mejores puntajes, se calcula un score optimizado generando una alineamiento exacto usando programación dinámica restringido a una franja alrededor del alineamiento inicial. • ktup alto favorece la selectividad, ktup bajo incrementa sensibilidad.

  13. Salida (output) fasta -E 2.0 -f -16 -g -4 -s dna.mat -O clase.txt VipRo.txt m15pla~1.seq 6 VipRo.txt, 160 aa vs m15pla~1.seq library 532 residues in 1 sequences results sorted and z-values calculated from opt score 1 scores better than 1 saved, ktup: 6, variable pamfact dna.mat matrix, gap penalties: -16,-4 joining threshold: 47, optimization threshold: 32, width: 16 scan time: 0:00:00 The best scores are: initn init1 opt m15pla~1 159 159 194 >> m15pla~1 (532 nt) initn: 159 init1: 159 opt: 194 59.048% identity in 105 nt overlap

  14. 30 40 50 60 70 80 VipRo. GAGAGCTGGCTAACTTAATTAATGTATGTGTATATCCTGATAAA---TGAATGCATTCT- :::..: : .::: :: : ::: : AATATNNCTGGGNAAAANGGGAGGGAATTTTG 10 20 30 90 100 110 120 130 140 VipRo. TTATGATACTTTCTACCGTATGAATCTTTTGGGAAGAACGCGACTTTGTAGGGGCGGGAG X::::..: :.: .::.: ::: :: :: :::.: :: : :: :.:: :::::::::X TTATGNNAATNTTNACNGGATGGATTTTCGGGGNAAAAAGAGAATNTGAAGGGGCGGGAA 40 50 60 70 80 90 150 160 VipRo. CCGATAGAGGCCAGA :....: :::.. :: CNNNNAAAGGNNGGAGAAAATTTAAAGNTAAGTTTTCAATNCCATTNACCNTTTTGGTTN 100 110 120 130 140 150 Library scan: 0:00:00 total CPU time: 0:00:00

  15. BLAST • BLASTP • BLASTN • BLASTX (ADN contra una base de datos de proteínas) • TBLASTN (proteína contra una base de datos de ADN) • TBLASTX

  16. Algoritmo BLAST • Secuencias s y t • |s| = m, |t| = n • word: default ADN =11, default proteínas = 3

  17. Paso 1 - Indexación • Se generan un índice a cada word de la secuencia s y de todas las secuencias t de la base de datos: s = TCATATCACGGCCC... Con w = 11 words: TCATATCACGG CATATCACGGC ATATCACGGCC ...

  18. Paso 2 – Búsqueda Inicial • Cada word de la secuencia s es comparada con el índice de la base de datos y se le da un score. • ADN: match = +1, mismatch = -3 • Proteínas: Se utiliza una matriz de sustitución • Se descartan aquellas words con puntaje menor a un umbral T (ADN = 0, proteínas = 11) • Los resultantes se los llama HSPs (High-scoring Segment Pair).

  19. Alineamientos: s = TCAGATCACGG... t = TGTCAGCTAACGGCC... word s: TCAGATCACGG word t: TGTCAGCTAAC GTCAGCTAACG TCAGCTAACGG ... Score: -21 Score: -25 HSP Score: 3

  20. Paso 3 – Extensión • Se extienden los HSP en ambas direcciones... • ...hasta que el score llega a un umbral.

  21. s = TCAGATCACGG... t = TGTCAGCTAACGGCC... Alineamientos: Score: 3 Score: 4 Score: 5 Score: -29

  22. Paso 4 – Inserción de gaps • Los gaps son agregados para conectar HSPs. • Un gap será agregado si el costo de unir dos HSPs es positivo.

  23. Expect (E) • E = la frecuencia esperada de un score en la base de datos. • Un match solo será mostrado si su E es menor que un umbral.

  24. Salida (output) BLASTN 2.0.11 [Jan-20-2000] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Query= (160 letters) Database: tcruzi 206 sequences; 160,103 total letters

  25. Distribution of 41 Blast Hits on the Query Sequence

  26. Score E Sequences producing significant alignments: (bits) Value SIRE 317 5e-89 VIPPAPER 287 5e-80 VIP5P 287 5e-80 ... SIRE Length = 435 Score = 317 bits (160), Expect = 5e-89 Identities = 160/160 (100%) Strand = Plus / Plus Query: 1 ttaggagcttgtgaaaagaatgatcgtgggagagctggctaacttaattaatgtatgtgt 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1 ttaggagcttgtgaaaagaatgatcgtgggagagctggctaacttaattaatgtatgtgt 60 ...

  27. Mejora a BLAST • En lugar de extender (paso 3) todos los HSPs solamente se extienden aquellos que estén en la misma diagonal y a distancia A.

  28. PSI-BLAST PSI-BLAST: Position Specific Iterated-BLAST • BLAST. • Aquellos hits por arriba de un cierto umbral son utilizados para construir un alineamiento múltiple. • Se arma una matriz de sustitución específica para cada posición con el alineamiento múltiple. • BLAST con esta nueva matriz. • Se agregan los nuevos hits y se repite el proceso.

More Related