Bellringer

1. Bellringer Chemical structures that are involved in physiological processes, such as hemoglobin in blood, insulin that regulates blood glucose levels, and enzymes that regulate body functions, are all made of proteins. Name some parts of the human body that contain proteins.

2. Key Ideas • What is the process of gene expression? • What role does RNA play in gene expression? • What happens during transcription? • How do codons determine the sequence of amino acids that results after translation? • What are the major steps of translation? • Do traits result from the expression of a single gene?

3. Objectives: Transcription & Translation Today: • Describe gene expression • Explain the role of RNA in gene expression • Summarize transcription Tomorrow: • Explain how codons determine the amino acid sequence of a protein • Describe the steps of translation • Identify a complexity of gene expression

4. Gene Expression • How we get from DNA to traits.

5. Vocabulary • RNA • Gene expression • Transcription • Translation • Codon

6. An Overview of Gene Expression • So far, we’ve discussed the structure of DNA… being made of nucleotides that contain 1 of 4 different nitrogenous bases. • You should know that DNA’s job is to store genetic information. • You’ve also learned the cell cycle. • We’ll be spending the next few days on G1 of the cell cycle. • This is the phase where most of “living” takes place. • It’s the phase that proteins and traits are made.

7. The Purpose of DNA… • DNA provides the original information from which proteins are made in a cell, but DNA does not directly make proteins. The Purpose of Life The purpose of DNA itself is to house the information necessary for heritable traits…meaning that it holds the information from which proteins are made. This is what living is all about. The DNA in our chromosomes is like books on the shelf of a library… just waiting to be read.

8. An Overview of Gene Expression, • Gene expression is the manifestation of genes (contained in DNA) into specific traits. • What does manifestation mean? • This process takes place in two main stages, • THE CENTRAL DOGMA OF BIOLOGY = • DNA  mRNA  Protein  Trait • Transcription: the process of copying the directions for traits out of DNA by making mRNA • Translation: reading the directions copied in RNA and turning them into the amino acid sequences for the gene.

9. THE CENTRAL DOGMA OF BIOLOGY Directions to make HAIR COLOR ACTGAACTGCACTG… DNARNAPROTEINTRAIT

10. Directions for SKIN COLOR Directions for HOW TALL YOU ARE Directions for FRECKLES Directions for EYE COLOR Directions for HAIR COLOR Genes: The basic units of heredity. They are located on specific regions of chromosomes, contained in DNA. There are thousands of genes “written” into each of the 23 chromosomes in our cells. They come from the original genes given to us from mom & dad.

11. So What Does a Real Gene Look Like? • Pro-melanin-concentrating hormone • tacagcgtgtggcattctccccacattctccttcggctttacggagcagcaaacaggatggcgaagatgagcctctcttcctacatgttaatgctggccttttctttgttttctcacggcattttactttcggcctccaagtccatcaggaacgtagaagcgacatagtatttaatacattcaggatggggaaagcctttcagaaggaaataccgcagaagatcggttgttgctccttctctggaaggatacaaaaatgatgagagcggcttcatgaaggatgaagatgacaagaccacaaaggtacgtgtatgcagtctgccttttattgcactagagatgaaaacgatgtttacaattataagccacccagaagtaaattttgtattttaattttataaataggctacatacagtcattgtgtgtattaagataactaggaaaacgtcatacaaaccaggcatttccccattctatccagaatcttgtatcttgtctcgcatatggaggtaaagacagtatacagcatcttagaactgatcagcaagaatgttgtacaactgtattctagctctactctgaagaagacagctgggatacaaaccaatcttctcttcacagaacacaggctccaagcagaatctcgtaactcacggtctgcccctcagtctggctgtaaaaccttacctcgctctgaaaggaccagcagtcttcccagctgagaatggagttcagaatactgagtccacacaggaaaagagggaaattggggatgaagaaaactcagctaaatttcccataggaaggagagattttgacagtgagtagccttctaaacatgcaattcctacatattaattttataaaagagctctgagcttcactgagttggatctgaccataacaaaatcaagaccatagttcagttctatcaaatagtaggcagcccacgtcaaaatggggaatttttcaaaatcagtaatagtggtttgttttattctggattcattataagtccacagattctcttaattctgtgtggtaattatagtcattgtttgttccttttcagtgctcaggtgtatgctgggacgagtctaccgaccctgttggcaagtctgatacctgctggtccacaacatcctttcagaagaaaacgattcattgcaagtggagagaaaagcccttaatgttgatgtaacttgtgtatcatcctaaatgtctgttttaaaagaaactggttacaatatgtaaatgctatgtaaatgatatgctttgacttgtgcattaaacttcacaaaaattctgcata • -http://www.ncbi.nlm.nih.gov/gene/24659#reference-sequences

12. Hemoglobin Gene • TACCACGACAGAGGACGGCTGTTCTGGTTGCAGTTCCGGCGGACCCCGTTCCAACCGCGCGTGCGACCGCTCATACCACGCCTCCGGGACCTCTCCTACAAGGACAGGAAGGGGTGGTGGTTCTGGATGAAGGGCGTGAAGCTGGACTCGGTGCCGAGACGGGTCCAATTCCCGGTCCGTTCTTCCACCGGCTGCGCGACTGGTTGCGGCACCGCGTGCACCTGCTGTACGGGTTGCGCGACAGGCGGGACTCGCTGGACGTGCGCGTGTTCGAAGCCCACCTGGGCCAGTTGAAGTTCGAGGATTCGGTGACGGACGACCACTGGGACCGGCGGGTGGAGGGGCGGCTCAAGTGGGGACGCCACGTGCGGAGGGACCTGTTCAAGGACCGAAGACACTCGTGGCACGACTGGAGGTTTATGGCAATTCGACCTCGGAGCCATCGTCAAGGAGGACGGTCTACCCGGAGGGTTGCCCGGGAGGAGGGGAGGAACGTGGCCGGGAAGGACCAGAAACTTATTTCAGACTCACCCGCCG • http://www.bio.davidson.edu/courses/Bio111/Hemomut.html

13. Gene Transcription and TranslationWhere Does it Occur?

14. RNA: A Major Player • All of the steps in gene expression involve RNA. • What exactly is RNA, & how does is compare to DNA? • First, like DNA, RNA is a nucleic acid made of nucleotide subunits linked together.

16. RNA vs. DNA • RNA is a nucleic acid like DNA • But RNA differs from DNA in 3 ways. • First, RNA usually is composed of one strand of nucleotides rather than two strands. • The exception occurs in viruses • Second, RNA nucleotides contain the five-carbon sugar ribose rather than the sugar deoxyribose. • Third, RNA nucleotides have a nitrogenous base called uracil (U) instead of the base thymine (T). • Uracil (U) is complementary to adenine (A) whenever RNA pairs with another nucleic acid.

17. DNA vs RNA Structure • DeoxyriboseNucleic Acid = DNA • Is missing one oxygen in the ribose sugar. • Ribose Nucleic Acid = RNA • Has all oxygens

18. Visual Concept: Ribonucleic Acid (RNA)

19. RNA: A Major Player • In cells, three types of RNA complement DNA and translate the genetic code into proteins. 1. Messenger RNA (mRNA) is produced when DNA is transcribed into RNA. • The mRNA carries instructions for making a protein from a gene and delivers the instructions to the site of translation.

20. RNA: A Major Player 2. Transfer RNA (tRNA) “reads” the instructions carried by the mRNA at the site of translation, then translates the mRNA sequence into protein subunits called amino acids. 3. Ribosomal RNA (rRNA) is an RNA molecule that is part of the structure of ribosomes. • Recall from CH7, ribosomes are the cellular structure where protein production occurs.

21. Objectives • Define Transcription • Summarize the steps of transcription • In order to help keep this straight, make a chart like the one below.

22. Transcription: Reading the Gene • Transcription Steps • Transcription begins when RNA polymerase binds to the specific DNA sequence in the gene that is called the promoter. • The promoter’s role is to signal the RNA polymerase where to start transcription. • The DNA always contains the sequence TAC for the “start” signal.

23. Transcription: Reading the Gene 2. RNA polymerase then unwinds and separates the two strands of the DNA double helix to expose the DNA bases on each strand.

24. Transcription: Reading the Gene, 3. RNA polymerase moves along the bases on the DNA strand and adds complementary RNA nucleotides to a growing mRNA as it “reads” the DNA of the gene until it reaches the “stop” signal. • Remember that in transcription “U” matches with “A”, not “T” like in replication. • The “A” still matched to “T” though. • As RNA polymerase moves down the DNA strand, a single strand of mRNA grows. • Just as there is a “start” signal on the DNA, signaling the start of the gene, there is a “stop” signal as well. • This region is specially designed to let the RNA polymerase know when the gene ends & therefore when to stop transcription. • This stop signal is one of 3 DNA sequences: • ATT, ATC, or ACT. • What would the RNA sequences be? • UAA, UAG, or UGA

25. Visual Concept: Transcription

26. Transcription

27. Review • A gene is similar to a recipe. • Gene expression is like the process of baking a secret cake recipe, complicated because the recipe is written in a language the chefs don’t understand. • It is written as one long sentence composed of just one word. • The word is written in the language of the nitrogenous bases, A, T, G, & C • A gene is written in a unique language that must be transcribed by a messenger that speaks the language of the chefs. • The way the recipe is delivered to the chefs (the ribosomes) in the cytoplasm (the bakery) is by the messenger “mRNA”. • mRNA copies the recipe during transcription and delivers it to the bakery in the cytoplasm for translation to occur (decoding the recipe in a different language to allow for baking the recipe). • In the cytoplasm the recipe is translated into the language of proteins (amino acids) and finally made into proteins. • Finally, the secret cake is made. • Now it’s your turn to read the recipe.

28. Practice Transcription…making an mRNA complement to the gene in DNA. DNA= TCTACAGGAGCGCTGGCAAGACTGCCG RNA= You make it. • Examine the DNA sequence above. • Look through and identify the promoter region containing the “start signal” of DNA. Underline it. • Do the same for the “stop signal”. • Write an RNA sequence of bases using the complement to the entire DNA sequence using the RNA bases (A-U-C-G), starting with the sequence of the “start” site all the way until you reach one of the 3 “stop” sequences. • Only write the RNA sequence that complements the DNA sequence from the “start” to “stop” signals. • You have 5 minutes. Ask questions if you need to.

29. Practice… DNA: TCTACAGGTGCAAGACTGCCG mRNA: • Find the start sequence…underline it. • Find the stop sequence…underline it. • Starting with the start sequence, transcribe the gene using the RNA bases. • What you end up with is an mRNA transcript of the gene contained in the DNA.

30. In-class Exercise/HW • Practice Transcribing: • You’re going to play the role of the messenger now. You need to be able to take a DNA sequence and identify the mRNA that will “copy” the recipe, the gene for a protein, so the recipe can be made by the ribosomes. Gene Xlr23: CGAACCTACAGTTCCGCGTCGGGCTAGACTGGCAATG • Copy this sequence down on a sheet of paper. • Identify the “start” sequence within the DNA above (underline it). • From the start sequence, count in groups of three until you reach one of the three “stop” signals. • What is the “stop” sequence (underline it). • Just below the DNA sequence you copied, transcribe the DNA into a sequence of mRNA for the gene Xlr23. Tomorrow we will use this sequence to practice translation.

31. Objectives Day 2 • Explain how codons determine the amino acid sequence of a protein • Describe the steps of translation • Identify a complexity of gene expression • This is a short lecture so stay focused.

32. The Genetic Code: Three-Letter “Words” DNA • What is the mRNA you decoded for gene Xlr23? TACAGTTCCGCGTCGGGCTAGACTGG AUGUCAAGGCGCAGCCCGAUCUGA • Save this and we’ll move on… • What do you notice that is similar about the start and stop sequences? • There is significance in the number 3 in RNA. • It corresponds to what’s called a codon. • A codon is a three-nucleotide sequence in mRNA. mRNA

33. The Genetic Code: Three-Letter “Words” • A codon is a key that corresponds to 1 of 20 amino acids. • An amino acid is the building block of a protein. • Codons also act as the start or stop signal for translation. • These “signals” are referred to as “start” and “stop” codons on mRNA in genetics. • So the start codon is…AUG (signals the start of the gene) • The stop codons are… UAA, UGA, UAG (signals the end)

34. The Genetic Code: Three-Letter “Words” • Refer to you handout. • There are 64 mRNA codons. • The mRNA that is created in transcription is actually a collection of a series of 3-nucleotide sequences called codons. • So each gene will contain nucleotides in multiples of 3

35. The Genetic Code: Three-Letter “Words” AUGUCAAGGCGCAGCCCGAUCUGA • Your practice from last night… • Notice that the length of the gene is a multiple of 3… • This is the way all genes are…in multiples of 3. • This is why I asked you to count by threes until you reached the “stop” codon. AUG-UCA-AGG-CGC-AGC-CCG-AUC-UGA

36. The Genetic Code: Three-Letter “Words” • Each codon specifies for only one amino acid, but several amino acids have more than one codon. • See leucine • This system of matching codons and amino acids is called thegenetic code. • The genetic code is based on codons that each represent a specific amino acid. • This is the translation tool that helps to translate the mRNA from the nucleotide language into the language of amino acids.

37. Figure 13. The amino acid coded be a specific mRNA codon can be determined by following the three steps below. What amino acid does the codon GAA code for? Codons in mRNA

38. Translation: RNA to Proteins • Translation is the process that changes the mRNA molecule into the complementary amino acid sequence. • Takes place in the cytoplasm • occurs in a sequence of 5 steps • Involves all three kinds of RNA • and results in a complete polypeptide.

39. Translation: RNA to Proteins • Translation relies upon the tRNA molecule to act as the go-between for mRNA codon & the amino acid that corresponds to it. • There is only one specific amino acid for each codon. • The mRNA gets matched up with the right tRNA molecule because of the anti-codon region • An anticodon is a three-nucleotide sequence on tRNA that is complementary to an mRNA codon.

40. AMINO ACID GOES HERE • There are two important regions of a tRNA. • The area where the amino acid attaches & • The anticodon region, which is complementary to the codon of mRNA • The anticodon always decides which amino acid is carried. tRNA matches mRNA here

41. The Steps to Translation

42. Translation: RNA to Proteins, • Step 1 • A ribosome attaches to the mRNA • The UAC (methionine) tRNA attaches to the start codon on mRNA within the ribosome. • Step 2 • The tRNA molecule that has the correct anticodon and amino acid binds to the second codon on the mRNA. • A peptide bond then forms between the two amino acids, and the first tRNA is released from the ribosome.

43. Translation: RNA to Proteins, • Step 3 • The ribosome then moves one codon down the mRNA, kicking the 1sttRNA out. • The amino acid chain continues to grow as each new amino acid binds to the chain and the previous tRNA is released. • Step 4 • This process is repeated until one of three stop codons is reached. • A stop codon does not have an anticodon, so protein production stops.

44. Translation: RNA to Proteins, • Step 5 • The newly made polypeptide falls of the ribosome, the tRNA leaves the ribosome, & the ribosome falls apart. • Translation is complete & the polypeptide is free to go get processed into a protein in either the ER or the Golgi. • This is where translation ends but it doesn’t have to be the only protein made. • Repeating Translation • Many copies of the same protein can be made rapidly from a single mRNA molecule because several ribosomes can translate the same mRNA at the same time.

45. Translation: RNA to Proteins

46. Methionine Serine AGU UAC PEPTIDE BOND FORMS: Then the ribosome moves forward RIBOSOME Anticodon mRNA AUG UCA AGG CGC AGC CCG AUC UGA Start Codon: Always triggers the attraction of the tRNA for methionine. Start Codon Other amino codons Stop Codon

47. Serine UAC AGU Methionine Anticodon mRNA AUG UCA AGG CGC AGC CCG AUC UGA

48. ? AGU UCC PEPTIDE BOND FORMS: Then the ribosome moves forward Serine Methionine The growing chain of amino acids is a polypeptide, or in other words…a protein Anticodon mRNA AUG UCA AGG CGC AGC CCG AUC UGA

49. ? UCC GCG PEPTIDE BOND FORMS: Then the ribosome moves forward Serine ? Methionine Anticodon mRNA AUG UCA AGG CGC AGC CCG AUC UGA

50. ? GCG UCG PEPTIDE BOND FORMS: Then the ribosome moves forward ? Serine ? Methionine Anticodon mRNA AUG UCA AGG CGC AGC CCG AUC UGA