Transcription, Translation, Mutation,

1. Transcription, Translation, Mutation, & Natural Selection

2. Fig. 8.2

3. Transcription • Synthesis of RNA from a DNA template • The RNA is complementary to one of the DNA strands (the other strand is not transcribed) • RNA polymerase catalyzes the reaction • RNA is single-stranded

4. Transcription • Begins at a promoter sequence in the DNA • 5’ to 3’ • Ends at a terminator • Uracil is used instead of thymine • Transcibe: 5’ accgtatcgacgtta 3’

5. Fig. 8.7 Inhibited by rifampin

7. Translation • Ribosome and tRNA read the mRNA • mRNA instructs what protein is to be made • mRNA is read in groups of 3 nucleotides • Each group of 3 is a codon • Each codon represents an amino acid, except for 3 stop codons

8. Translation • 64 possible codons • 20 amino acids • The genetic code is degenerate (also redundant) Fig. 8.8

9. Translate this mRNA • 5’ acugcaugaaacucgacuucuagccacug 3’

10. Homework Problem • 5’ cagctagaatggtaagcggtcatcaatggtgttccaatgtgctataaaaactagggtgacc 3’ • Give the DNA complement • Transcribe the complement into mRNA • Translate the mRNA into protein

11. 3 Types of RNA • Messenger RNA – will be translated into protein • Transfer RNA and ribosomal RNA are involved in translating the mRNA

12. fig. 8.9 Tetracyclines inhibit tRNA binding

13. Chloramphenicol prevents peptide bond formation

14. Aminoglycosides cause the ribosome to make errors in reading the mRNA

15. Macrolides prevent ribosome movement along mRNA

17. Antibiotics interfere w/Translation Fig 20.4

18. Transcription and Translation are simultaneous in prokaryotes Fig. 8.10

19. Mutations Alterations in DNA

20. Effects of Mutations(on the organism) • Mutations can lead to death • Mutations can cause slower growth (sickness) • Mutations can have no obvious effect • Mutations can provide an advantage

21. Effects of Mutations(on the gene & protein) • Change the amino acid sequence of a protein – affects the activity of a protein. • Coding region. • Change the binding site of RNA polymerase (promoter). • Non-coding regions.

22. See also fig. 8.16

23. Silent Mutations • Genetic code is redundant! • CUC and CUA and UUG all code for leucine • Mutations in non-coding regions can also have little or no effect

25. Types of Mutations • Point mutation = base substitution  one nucleotide is substituted for another missense mutation – changes the amino acid sequence nonsense mutation – introduces a stop codon • Frameshift mutation – results from an insertion or deletion of nucleotides

27. Fig. 8.16

29. Mutations can occur spontaneously. • Error rate during replication in E.coli is approx. 1:1010 • DNA polymerase possesses a proofreading function (not really repair). • Frequency of mutation is increased by various mutagens.

30. Proofreading by DNA Polymerase

31. Mutagens • Also known as carcinogens for their ability to cause cancer in multicellular organisms. • Chemicals – many pesticides, nitrosamines, benzpyrene, etc. • Physical – irradiation (X-rays, UV, g rays, etc.).

32. Nitrous Acid Fig. 8.17

33. UV Light Fig. 8.19

34. DNA Repair • Most cells possess enzymes that can repair some DNA damage. • There is only a finite capacity to fix the damage.

35. Mutation as an Agent of Evolution • Survival of the Fittest does NOT mean the strongest survive!! • The “fittest” are simply those that have a better chance of reproducing (and passing on their DNA). • Sometimes the fittest are those that are weaker in some way; others may cooperate with other species (symbiosis).

38. Mutations may weaken an individual, but make it more likely to survive in a particular environment. • Example: mutations in the ribosome often cause slower growth (a sign of “sickness”), but allow the cell to resist macrolide antibiotics. • So survival of the fittest may actually involve a weakening of the individual.

40. Some Human Mutations • Sickle Cell Anemia – mutation in hemoglobin gene. • Increased resistance to malaria. • Cystic Fibrosis – mutation in a chloride ion channel gene. • Increased resistance to cholera? • Tay-Sachs Disease – mutation in a lysosomal gene. • Increased resistance to tuberculosis?

41. Darwin’s Natural Selection • Nature “selects” certain individuals among a diverse population to survive. • An organism’s environment is constantly changing, i.e. newly introduced antibiotics. • Only certain individuals possess the ability to survive and reproduce under the new conditions. • Thus, future generations will contain traits (antibiotic-resistance) similar to those that successfully reproduced.

42. One of the keys to natural selection is the existence of a diverse population. • The greater the diversity, the greater the chance that some individual(s) will survive in the new environment. (It is not necessarily possible to predict what the new environment will be like.) • This diversity is at the genetic level. • Random mutations can create this diversity.