Transcription and Translation Practice

1. Transcription and Translation Practice TACGCTGACGAGAAATTAATTTCCTTGACT Write the mRNA Translate the mRNA into a protein.

2. Chapter 18 Your mama is a llama… Well, she actually just shares many genes with a llama. So do you. No spitting, please.

3. Bacteria, Environment, & Gene Expression • Operons • A group of genes involved in the same process controlled by one promoter. • Called a transcription unit • One long mRNA is produced for all the genes. • Proteins are translated separately…not one big protein. • Operator – control module for transcription • Contained within the promoter or between promoter and start site • Controls access of RNA pol to genes • Benefit: One on/off switch controls all genes in pathway • Called coordinate control

4. The Tryptophan Operon (Repressible Operon – usually anabolic) • Five genes encode enzymes for tryptophan synthesis. • Default setting in “on” for transcription a) trp repressor binds operator to turn transcription off. 1) trp repressor is allosteric protein 2) in absence of tryptophan, trp repressor is off 3) when tryp is present, it binds repressor, activating it so it turns off operon 4) Tryp is a corepressor in this instance Trp repressor is a regulatory gene. It is expressed continuously but not necessarily in its active form

5. Lac Operon (Inducible Operon – usually catabolic) • Three genes involved in lactose digestion • Default setting is off • lacI is a repressor protein. (regulatory gene) • Synthesized in an active form • An inducer protein (allolactose) binds to lacI protein and inactivates it. • Allolactose is a form of lactose so when you eat dairy it is there. Both of these operons are under negative control. Negative because the object that binds the operator of the operon is a repressor.

6. Positive Regulation of the Lac Operon • The Battle between Good (glucose) and Not-as-good (lactose) • Meaning the cell will use glucose as food source if it is available. • Catabolite Activator Protein (CAP) is a gene activator • Default state is inactive • When glucose is scarce, cAMP is produced. • cAMP binds CAP and activates it, which goes and activates the lac operon. • If glucose is present, then CAP is inactive and operon is much less active, even if lactose is present.

7. II. Eukaryotic Gene Regulation • Differential Gene Expression • The expression of different genes by cells with the same genome. • Differentiated cells express a low percentage of the total # of genes • Many different control points for control of gene expression

8. Control via Chromatin Structure • location of promoter relative to histones. • location in heterochromatin or euchromatin • Chemical modification of histones • N terminus of histones is accesible for modification • acetylation – prevents binding to neighboring nucleosomes. • makes DNA more accessible • methyl groups – makes DNA less accesible • phosphate next to methyl – makes DNA more accessible. • histone code hypotesis – modification of histones determines chromatin structure and therefore gene regulation

9. DNA methylation • inactive DNA is highly methylated • inactive X-chromosomes • removal of methylation activate histone acetylation…gene expression • seems to be more permanent • genomic imprinting – methylation of either paternal or maternal allele for expression from one chromosome only.

10. Epigenetic Inheritance • changes in phenotype (appearance) or gene expression caused by mechanisms other than changes in the underlying DNA sequence • passed on from one cell to another in DNA replication and cell division • often involves modifications to chromatin • often a factor in development and differentiation of cells.

11. Regulation of Transcription Initiation • Control elements play a key role • sequences of DNA where other proteins bind to control transcription. • Transcription Factors • general transcription factors required for all transcription

12. Enhancers and specific transcription factors • proximal control elements – located close to promoter • distal control elements – located farther away…called enhancers a} may be upstream or downstream b} other proteins may bend DNA bringing enhancer closer to promoter c} proteins binding at enhancer interact with RNA pol to initiate transcription. d} repressors may block RNA pol or prevent other transcription factors from interacting with RNA pol. e} repressors may affect chromatin structure via recruitment of histone modifiers f} seems to be a common method for silencing genes

13. Combinatorial control of expression • enhancers have binding sites for multiple proteins (control elements) • however only one or two proteins may bind enhancer • combination of control elements controls transcription.

14. coordinately controlled genes • some genes that work on the same process are located near each other in genome. • changes in chromatin structure affect all those genes at one time • some related genes share a promoter but create multiple mRNAs (bacteria operon only one mRNA) • more often, combination of control elements controls all genes in the group (like metabolic pathway genes) even if on different chromosomes. • sometimes an extracellular signal enters the cell and binds a transcription factor activating it and allowing for the expression of multiple related genes (steroid production) • signalling molecules can do the same thing via signalling pathways.

15. Post transcriptional control of expression • RNA processing • alternative RNA splicing • different RNA from same mRNA due to splicing differences • controlled by regulatory proteins • mRNA degradation • specific sequences in the untranslated region (UTR) dictate how long an mRNA exists

16. Initiation of Translation • regulatory proteins may bind mRNA and prevent translation • some stored mRNA in eggs (not chicken) have no poly-A tail…no translation. • poly A tail added later in development. • global control of general translation factors • in eggs translation factors are inactive until fertilization occurs. • light and darkness can also control translation factor activity

17. protein processing and degradation • proteins are often modified after translation • modification proteins controlled by phosphate addition and removal • regulation could also occur at the transportation level. • protein lifespan is also controlled • tagging of proteins with ubiquinone signals their degradation by proteasomes. • mutations in proteasomes can cause cancer

18. Non-protein coding RNAs and Gene Expression • Effect of miRNAs • microRNAs (miRNA) bind to sequences in mRNA • Production of miRNA • Once transcribed, fold back upon themselves creating multiple hairpins • Hairpins are cut from one another by the Dicer and one of the hairpin strands is removed • miRNA binds and protein and whole complex binds mRNA • Binding of miRNA complex either blocks translation or signals for degradation

19. RNA interference and small interfering RNA • Experimentally: injection of double stranded RNA blocked gene expression of mRNA with same sequence • siRNA do the same thing • siRNA differ from miRNA is that they come from much longer double stranded RNA • Many siRNAs come from one double stranded RNA • siRNAs identified in fruit flies and c. elegans

20. Chromatin Remodeling and Silencing by small RNAs • Important for formation of heterochromatin in yeast • Bind to DNA and recruit enzymes that modify DNA making it heterochromatin • Evidence: inactivation of Dicer results in no heterochromatin formation in chicken and mouse cells

21. Differential gene expression and cell differentiation Embryonic Development Cell differentiation – the process by which cells become specialized in structure and function. Morphogenesis – physical processes that give an organism its shape. Big Question: How do different sets of activators come to be present in two cells?

22. Cytoplasmic Determinants and Inductive Signals • Proteins and mRNA are present in the unfertilized egg (cytoplasmic determinants) • Not evenly distributed throughout the egg • First cell divisions result in unequal distribution of the proteins and RNA in new cells • Different proteins = different genes activated • Cell-cell interactions also play a role (induction) • Binding of cell surface receptors (signalling pathways) results in activating of different genes

23. Sequential regulation of gene expressions Determination – the events that lead to the observable differentiation of a cell • Once determination occurs, it is irreversible • Determination caused by the expression of genes which encode of tissue specific proteins • Master Regulatory Genes • Key genes involved in the determination of a cell • Often these are transcription factors that activate other tissue specific proteins

24. Pattern formation: setting up the body plan • Begins very early • Establishment of the major axes of the embryo • This positional information is provided by cytoplasmic determinants and inductive signals • Drosophila • Fed drosophila mutagens and then looked at dead larvae with pattern formation mutations. • Identified 1200 genes involved in pattern formation • 120 genes involved in segmentation

25. Axis establishment in drosophila • Maternal effect genes are genes that encode for proteins or mRNA that are put into the egg during oogenesis a} often called egg polarity genes • Example: bicoid a} bicoid mutants have no anterior end…two posterior ends form b} there must be a morphogen gradient meaning a gradient of proteins involved in anterior posterior identity c} found experimentally that bicoid mRNA is concentrated at one end of egg. d} if inject bicoid protein into different places of the embryo get anterior formation occuring in multiple places.

26. Cancer mutations and the cell cycle • Types of Genes associated with Cancer • Growth factors, growth factor receptors, intracellular molecules of signalling pathways • Viruses can also cause cancer • HPV (Papillomaviruses) – cervical cancer • Sexually transmitted disease • Debate to vaccinate young girls (11-12) • Will it encourage them to be sexually active if they are protected from a STD?

27. Oncogenes and proto-oncogenes • Proto-oncogene is a gene involved in the cell cycle. It is called an oncogene when a mutation in it causes cancer • Usually mutation causes and increase in the amount of protein produced or the proteins activity • Causes: • movement of DNA – cancer cells often have broken chromosomes (one piece translocated onto another) and gene is placed near an enhancer that expresses it more than normally. • amplification of DNA – increase in the number of copies in the cell • mutation in control element or gene

28. Tumor-supressor genes • Normal versions of these genes inhibit cell division • Functions • Repair damaged DNA • Cell adhesion to other cells or ECM • Components of cell-signaling pathways • Interference with Cell-signaling pathways 1. ras proto-oncogene • G-protein involved in a growth factor receptor. Activates a kinase • Normal end result is increase in cell division • Mutation in ras results in hyperactive protein that is always activating kinase.

29. p53 • Transcription factor that stimulates proteins that inhibit cell cycle when there is DNA damage • p53 also controls DNA repair genes. • p53 can also activate apoptosis genes if DNA damage is too significant

30. Multi-step model for cancer development • Multiple mutations are necessary for cancer to develop. • Since there are two copies of almost every gene, both copies must often be mutated. • Cancers usually involve one oncogene mutation or mutations in multiple tumor supressor genes • Hence, cancer more likely to develop later in life • Genetic Predisposition to Cancer (Inheritance) • If you inherit one bad gene, you are closer to developing cancer than someone who hasn’t.