Missed topic – lateral flow immunochromatography assays Common format for home tests (e.g. HCG - pregnancy) and now m

1. Missed topic – lateral flow immunochromatography assays Common format for home tests (e.g. HCG - pregnancy) and now many medical lab tests

2. Questions – how many gold particles at what density for easily visible line? why are they visible – details of surface plasmon resonance, effect of particle size how many patents, who owns them? issues re: home testing, FDA approval

3. Intro to DNA, RNA for engineers Main Points How to copy, cut, paste (rearrange) pieces of DNA Make RNA from DNA and vice versa Some engineering applications of nucleic acids capturing/detecting other molecules bind complementary DNAs, RNAs bind other small molecules e.g. carbon nanotubes (!) constructing novel, nano-scale structures

4. DNA Base pairing – at edges – holds strands together Base stacking – above & below - compresses ds into helix Boiling separates strands N 3’ 5’ 5’ 3’ RNA – like DNA, except OH at 2’ position, and Uridine for Thymine

5. http://www.google.com/images?q=DNA&hl=en&gbv=2&tbs=isch:1,simg:CAISEglYWPmrg53qoyHd2bQ6MaaJlA,sit:o&iact=hc&vpx=409&vpy=76&dur=1373&hovh=232&hovw=217&tx=73&ty=305&ei=theBTJiwK4aBlAf_zpWuDg&oei=theBTJiwK4aBlAf_zpWuDg&esq=1&page=1&tbnh=127&tbnw=118&ved=1t:722,r:12,s:0&biw=956&bih=572http://www.google.com/images?q=DNA&hl=en&gbv=2&tbs=isch:1,simg:CAISEglYWPmrg53qoyHd2bQ6MaaJlA,sit:o&iact=hc&vpx=409&vpy=76&dur=1373&hovh=232&hovw=217&tx=73&ty=305&ei=theBTJiwK4aBlAf_zpWuDg&oei=theBTJiwK4aBlAf_zpWuDg&esq=1&page=1&tbnh=127&tbnw=118&ved=1t:722,r:12,s:0&biw=956&bih=572 3 5 5 3 1 4 5 2 3 3 5 Cut at P -> one 3’ and one 5’ end; usually P stays at 5’ end 5 3 3 5 5 3 OH in RNA

6. Watson-Crick base pairs G-C 3 hydrogen bonds A-T 2 hydrogen bonds weaker than G-C purinespyrimidines (2 rings) (1 ring)

7. Practical consequences of double helix structure DNA replication method based on separating strands, assembling new copy on single-stranded template via base pairing and ligating new bases to growing chain engineering application – pol. chain rxn. (pcr) Sequence-specific binding between strands with complementary sequence – many applications! dsDNA is stiffer than ssDNA – applications in single- molecule sensing methods using DNA tethers Nature has evolved variety of enzymes that unwind, cut, religate, repair DNA = energy-consuming nanomachines

8. Enzymes that act on DNA or RNA, useful to engineer pieces of DNA with desired sequence 1. DNA polymeraseN strands are “anti-parallel” adds bases to 3’-end pol requires primer to start synthesis primer template

9. Short pieces of DNA (“oligo”nucleotides~1-100 bases) can be chemically synthesizedN, commercially available for ~$1/base for 100nmol = 6x1016 molecules Can be modified by attaching biotin, fluors, other small chemical labels – useful as capture molecules, hybridization probes, as primers to initiate copying at specific starting point on template DNA strand -> method for exponential synthesis of segment of DNA = polymerase chain reaction or pcrN

10. Pcr amplification of DNA using thermostable DNA polymerase (e.g. Taqpol) copy strand (B) forward primer Taqpol template strand (A) Melt DNA (94oC), cool (60oC) to anneal primers, extend (72oC) new strand A reverse primer

11. Old and new templates are not destroyed by melting, so repeated cycles of melting and polymerization -> 1 -> 2 -> 4 -> 8 -> … -> 2n copies of DNA region lying between 2 primer-annealing sites on initial template Polymerase copies ~1000b/min => ~1 hour for 230 =1010-fold amp. of a kb piece of DNA http://www.youtube.com/watch?v=_YgXcJ4n-kQ http://www.dnalc.org/ddnalc/resources/animations.html

12. Portion of sequence of lambda phage DNA convention: seq reads 5’->3’, seq of only one strand of dsDNA is shown 1 gggcggcgacctcgcgggttttcgctatttatgaaaattttccggtttaaggcgtttccg 61 ttcttcttcgtcataacttaatgtttttatttaaaataccctctgaaaagaaaggaaacg 121 acaggtgctgaaagcgaggctttttggcctctgtcgtttcctttctctgtttttgtccgt 181 ggaatgaacaatggaagtcaacaaaaagcagctggctgacattttcggtgcgagtatccg 241 taccattcagaactggcaggaacagggaatgcccgttctgcgaggcggtggcaagggtaa 301 Could you write sequence of opposite strand? Could you specify sequence of two 20 base primers to amplify segment consisting of bases 11-290? one primer must hybridize to sequence shown and be extended 5’->3’; other primer must hybridize to complement of sequence shown

13. 2. Reverse transcriptase is enzyme related to DNA pol that makes a DNA copy using ssRNA (or ssDNA) as template Useful for making (DNA) copies of RNA, then amplifying by pcr for detection or analysis RNA = chemical cousin of DNA, has extra OH at position 2 on sugar backbone and base U instead of T In living things, DNA is copied to RNA (transcription, by RNA polymerase) and RNA sequence “translated” into amino acid sequence in proteins by large complex of protein and RNA (ribosome); these rxns can now be carried out in vitro to make artificial proteins starting with DNA of arbitrary sequence

14. 3. Restriction EnzymesN– useful for “cutting and pasting” DNAs to rearrange segments, make new DNA molecules from preexisting DNA pieces Cut DNA backbone at specific short sequence; may leave ss overhang that can be used to direct assembly of DNA pieces with complementary overhangs EcoRI 5’--GAATTC-- 3’--CTTAAG-- NheI 5’--GCTAGC-- 3’--CGATCG-- AvrII 5’--CCTAGG-- 3’--GGATCC-- http://www.dnalc.org/resources/animations/restriction.html http://en.wikipedia.org/wiki/Restriction_enzyme

15. Map of enzymes that cut this circular DNA once What size piece(s) does cutting with EcoRI produce? Cutting with EcoRI + PstI? Cutting with SpeI + SacI? http://www.neb.com/nebecomm/tech_reference/restriction_enzymes/dna_sequences_maps.asp

16. Sizing DNA fragments by agarose gel electrophoresis Load DNA + fluor. dye that binds DNA run ~100V x 30min Illuminate gel with uv light D, known size DNAs: Why does DNA run from – to +? Why do smaller fragments run faster?

17. Given lane D results, which of the maps (A, B, or C) indicates HindIII sites?

18. Some RE’s are homodimers, cut palindromes Some are heterodimers, cut non-palindromes Mutations in one member of heterodimer can -> enzyme that cuts only one strand (“nicking”) Putting 2 nicking sites near one another allows you to create ss “gap” in dsDNA (nick and melt off ---------) gap potentially useful as capture molecule EcoRI5’--GAATTC-- 3’--CTTAAG-- BbvCI5’--CCTCAGC-- 3’--GGAGTCG— NtBbvCI5’--CCTCAGC-- 3’--GGAGTCG-- NtBbvCINtBbvCI ---------|--------------|------------ --------------------------------------

19. 4. Ligases reform phosphodiester bonds – join pieces of DNA reverse effects of restriction enzymes may be guided by annealing of complementary overhangs fragments A fragments B GATC--atc--- + GATC-gcc-- --tag---CTAG -cgg--TTAA note multiple possible ligation products: AA, A , AB, B, AAA…, A , gatcBBttaa,… Can you get BA, BBB? A A Bttaa gatcB

20. Cloning plasmid DNA in bacteria Small circular DNAs (plasmids) grow inside bacteria Plasmids can encode antibiotic resistance genes (e.g. ampr) Engineer plasmid DNA (e.g. cut with EcoRI, ligate in fragment with gene of interest, “transform” E Coli, select those that grow on plates w/ ampicillin, isolate plasmid DNA from individual bacterial colonies digest with EcoRI to see if DNA contains EcoRI insert) Note: need Eco RI not to cut gene of interest have to rely on chance location of restr. sites

21. Note some ligated fragments can be recut: EcoRI (GAATTC) EcoRI product restores EcoRI site 5’--G AATTC-- 3’ 5’--GAATTC-- 3’--CTTAA G-- 5’ 3’--CTTAAG-- Others cannot: NheI (GCTAGC) AvrII (CCTAGG) product = NheI or AvrII CGATCG GGATCC sequence 5’--G CTAGG--3’ 5’--GCTAGG-- 3’--CGATC C--5’ 3’--CGATCC— Can be useful to ligate pieces into plasmid, then recut to linearize/inactivate plasmid that has religated without insert \

22. pcr has partially replaced restriction enzymes as construction tool to genetically engineer DNA because it allows joining pieces of DNA at arbitrary positions, independent of fortuitous position of restriction sites Method uses “strand overlap extension”

23. Put small piece of dna 2 sequence at 5’ end of pcr primer for dna1 Strand overlap extension first pcr product C 5’ A template 1 B B 3’ C B bottom strand of product can anneal to DNA 2 to generate extension product that can be amplified with primers C and B to generate fusion product of DNA 1 and 2 with arbitrary junction, independent of restriction enz. 3’ template 2

24. 2 strand overlap extensions can generate arbitrary deletion

25. Circular permutation trick to allow pcr amplification of region of unknown sequence outside of region of known sequence 1 2 1 2 pcr with 1 and 2 2 1

26. “Nested” pcr provides single-template molecule sensitivity first pcr takes 1 molecule -> ~108 second pcr takes ~108 molecules -> ~1012 molecules by changing primers one avoids primer-dimer artifact

27. 7. RNA polymeraseN – partially melts dsDNA template and makes ssRNA copy Some RNA pol’s can use ssDNA as template Useful to make RNA copies of DNA engineering application: ssRNAs can fold into non- uniform shapes that bind small molecules (then called aptamers), sometimes used instead of Abs

28. Ribosome (protein-RNA complex) “reads” ssRNA sequence 3 bases at a time and assembles protein, amino acid by amino acid amino acid 1 amino acid 2 amino acid 3 … triplet genetic codeN

29. Central Biological Dogma: DNA <--> RNA -> protein DNA pol, pcr (reverse) The enzymes involved act as nanoscale motors walking along templates RNA pol ribosome

30. Summary DNA can be engineered – cut, copied, exponentially amplified, joined to other pieces, sequenced (next few weeks) with single base precision Methods take advantage of enzymes that perform component steps in living organisms Details of how these enzymes work as nanomachines is focus of current research, especially using methods that report on single-molecules

31. DNA is remarkable as polymer with variable sequence applications take advantage of properties that are function of adjustable length nanoscale tethers with well characterized linear and torsional spring constants variety of nanostructures – rings, multi-walled tubes, switches, emoticons (!) and properties that are function of sequence binding to complementary sequences binding to other molecules and nanostructures ability to make vast libraries of diff. seq. & select for ones with desired prop. diagnostic and therapeutic medical uses