1 / 6

PCR-reaksjon

PCR-reaksjon. Forward primer F461-pBET Med sekvens Ttcgccattcaggctacgcaactg [posisjon 461-484 i pBET] for amplifisering av pBET plasmider. Revers primer R1137-pBET Med sekvens cagtgagcgaggaagcggaagagc [posisjon 1137-1160 i pBET] for amplifisering av pBET plasmider. PCR.

vian
Download Presentation

PCR-reaksjon

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. PCR-reaksjon Forward primer F461-pBET Med sekvens Ttcgccattcaggctacgcaactg [posisjon 461-484 i pBET] for amplifisering av pBET plasmider. Revers primer R1137-pBET Med sekvens cagtgagcgaggaagcggaagagc [posisjon 1137-1160 i pBET] for amplifisering av pBET plasmider. PCR 700 bp Reaksjons- betingelser DNA sekvensering Subkloning

  2. Oversikt

  3. Analytisk PCR • Variable testet • Mg2+ konsentrasjon • 1- 2.5 mM • Noen forskjell? • Templat • Klonet plasmid • Kokte bakterier • Like lett å amplifisere? • Annealingstemperatur • 45 oC • 60 oC • 72 oC • Teoretisk Tm • Bruk 2+4 regelen til å estimere Tm • Kommenter hvordan disse ligger i forhold til annealingstemp

  4. Subkloning av PCR-produkt

  5. Finn en feil! • Blast vil vise hvilket gen PCR-produktet kommer fra • Vil også avsløre en mutasjon - bestem hvilken PCR

  6. Mer info • Forelesninger legges ut på: • http://folk.uio.no/oddsg/HTML%20files/KJB220.html

More Related