1 / 21

The principles of autozygosity analysis and its application in eye disorders

Leeds Institute of Molecular Medicine. The principles of autozygosity analysis and its application in eye disorders Chris Inglehearn Section of Ophthalmology and Neuroscience, Leeds Institute of Molecular Medicine.

ziya
Download Presentation

The principles of autozygosity analysis and its application in eye disorders

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Leeds Institute of Molecular Medicine The principles of autozygosity analysis and its application in eye disorders Chris InglehearnSection of Ophthalmology and Neuroscience, Leeds Institute of Molecular Medicine

  2. A consanguineous marriage is defined as a union between two individuals who are related as second cousins or closer.

  3. Perceived economic and cultural advantages, keeping wealth within the family and maintaining cultural identity http://www.cousincouples.com/info/facts.shtml “There are no contemporary studies that indicate cousins have children with significantly higher than normal birth defects. Fears of cousins who marry having children with birth defects are indeed exaggerated”.

  4. Clinical consequence • increase in; • risk of both common and newly described or very rare recessive diseases • spontaneous abortion • infant morbidity • infant mortality • Estimates vary widely but are consistently increased in children of consanguineous unions • 2.7% consanguineous risk versus 0.8% for an unrelated couple in Turkey • 15.8% consanguineous risk versus 5.8% unrelated risk in Palestinian Arabs

  5. Some say discourage consanguineous marriage - illegal in 39 states of the USA Counter-argument - purging of deleterious genes from the population, as seen in the south Indian Hindu population Consensus - discouraging or legislating against consanguinity is inconsistent with non-directive genetic counseling and unlikely to be effective. Therefore identify those at risk, provide appropriate risk information and offer carrier testing if available

  6. d II:1 II:2 II:3 II:4 d d d Autozygosity mapping Individuals whose parents are related will almost certainly be homozygous for a proportion of their genome due to chromosomal regions which are Identical By Descent (IBD) from one of the common ancestors. I:1 I:2 d III:1 III:2 d d IV:1 IV:2 d d

  7. SNPs • Single nucleotide polymorphisms • Over 10 million now identified CATGTTGATAGTTACCATGAT CATGTTGATATTTACCATGAT • Common, usually binary • Easy and quick to test

  8. Famille T ADK94 ADK93 ADK92 Jalili syndrome

  9. Primary congenital glaucoma

  10. Map

  11. Bradford Pakistani population - biggest community of Asian Muslims in UK • Approx 26% (136,000) of residents in Bradford District from ethnic minorities, vast majority of Pakistani origin. • As in founding population in Mirpur, Northern Pakistan, high level of arranged marriage, often between first cousins • 5% background homozygosity in members of this community

  12. sampled DNA from 62 multiplex and 22 simplex consanguineous families with recessively inherited eye diseases to date • 32 are UK families sampled in local ophthalmic clinics, remainder diagnosed and ascertained in Pakistan by Mr Martin McKibbin and Mr Hussain Jafri

  13. Current research • Retinal dystrophies – Retinitis pigmentosa, cone-rod dystrophy and Leber congenital amaurosis – Chris Inglehearn • Retinal Vascular diseases – FEVR, PHPV – Carmel Toomes • Anterior segment diseases – microcornea, microphthalmia, primary congenital glaucoma, anterior segment dysgenesis – Manir Ali • Strabismus, refractive error (Born in Bradford), keratoconus, corneal endothelial dystrophy – Manir Ali, Aine Rice • Amelogenesis imperfecta (AI), syndromic and isolated – Alan Mighell • Schizophrenia/depression – Andrew Cardno/Steve Clapcote • Retinal dystrophy diagnostic service currently under discussion • Especially interested in; deafness and/or retinal dystrophy with AI (Heimler syndrome), anterior segment abnormalities, keratoconus

  14. Leeds Institute of Molecular Medicine LIMM colleagues and collaborators Carmel Toomes Manir Ali Alan Mighell Dave Parry Aine Rice Martin McKibbin Moin Mohamed Adam Booth John Bradbury Hussain Jafri Yasmin Rashid c.inglehearn@leeds.ac.uk http://autozygosity.org/

More Related