1 / 69

A basic review of genetics

A basic review of genetics. Dr. Danny Chan. Associate Professor Assistant Dean (Faculty of Medicine). Department of Biochemistry The University of Hong Kong. Cells and genes. 50,000,000,000,000 cells. Mitochondria. (few more genes). Nucleus. (99.9% of the genes). Cells and genes.

anoki
Download Presentation

A basic review of genetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. A basic review of genetics Dr. Danny Chan Associate Professor Assistant Dean (Faculty of Medicine) Department of Biochemistry The University of Hong Kong

  2. Cells and genes 50,000,000,000,000 cells

  3. Mitochondria (few more genes) Nucleus (99.9% of the genes) Cells and genes ~20, 0000 genes

  4. Genes are on DNA NH2 5’ Cytosine N O CH2 O O O P N O O- O CH3 Thymine H N O O CH2 O O P N O O- O N Guanine N O CH2 O O P NH2 N N O O- NH2 Adenine N N O CH2 O O P N N O O- 3’ Deoxyribose Nucleic Acids DNA sequence  genetic code  genes

  5. Genes determine why we are the way we are!

  6. Genes are passed on from one generation to the next Genetic traits You have inherited genes from your father that make proteins instructing your hair cells or eye cells to produce hairs and eyes that are the same colours and shape as your father. Genetic traits can also be a behavior, feelings, or responses to a given environment

  7. DNA are super-coiled into chromosomes chromosome

  8. Human Genome 22 pairs of autosomes and 1 pair of sex chromosomes Sex chromosomes Autosomes

  9. Other primate chromosome numbers 24 pairs of chromosomes 21 pairs of chromosomes

  10. Other species 4 pairs of chromosomes 30 pairs of chromosomes 39 pairs of chromosomes

  11. The genome projects

  12. How similar are we to other species? ~93% ~98.5%

  13. How about with other humans? What makes us different from one another? ~99.5%

  14. Variations in DNA sequence or Polymorphisms • Variable number tandem repeats (VNTRs) • Microsatellites • Single nucleotide polymorphisms (SNPs) • Small insertions and deletions (Indels) • Copy number variations (CNVs)

  15. Variations in DNA sequence or Polymorphisms • Variable number tandem repeats (VNTRs) • Microsatellites • Single nucleotide polymorphisms (SNPs) • Small insertions and deletions (Indels) • Copy number variations (CNVs)

  16. Microsatellites Repeat units of nucleotides 1-6bp in length The most widely used are the (CA)nmicrosatellites 6 (CA) allele CACACACACACA 8 (CA) allele CACACACACACACACA

  17. Single nucleotide polymorphisms (SNPs) are substitutions, insertions or deletions of a single base T-allele TCGAGAGGCTAGGCTAGGA TCGAGAGGCCAGGCTAGGA Substitution C-allele (+) allele TCGAGAGGCTTAGGCTAGGA TCGAGAGGCAGGCTAGGA Insertion (-) allele deletion

  18. SNPs arise during DNA replication 3 x 109 bases 107 SNPs Opportunities for errors SNPs Single base errors/changes create

  19. Genetic differences and similarities between people You Genetic signature Rest of the world

  20. Some SNPs affect the way we look

  21. Some affect our susceptibility to diseases

  22. Others affect our response to drugs/pain

  23. or .. no differences! .. in health, personalities or responses to the environment

  24. SNPs affecting gene function Newly synthesized protein Gene mRNA Altered Protein Protein t-RNA

  25. Protein function and phenotype Altered protein function Altered Phenotype Altered Protein Protein

  26. A pair of homologous chromosomes Mum Dad Hair color Hair color Height Height Longevity Longevity Body fat Body fat Intelligence Intelligence Eye color Eye color

  27. Sperm Somatic cell 2 sets 1 set oocyte 1 set

  28. Meiosis (making sperm or oocytes) Meiosis II Meiosis I Diploid cell DNA replication Homologous chromosome pairing Four haploid cells

  29. Genetic recombination in meiosis Cross-over and exchange DNA Doubling Genes get shuffled during recombination

  30. Phenotypes Observable or measurable traits Genes + environment Begins in the womb and continues throughout life

  31. Phenotypes Differences in some phenotype are determined mostly by genes Height How genes influence personality, behavior and perception is less well understood

  32. Learning more about our phenotypes … from our genome We can now interrogate SNPs across our genome all at once Understand how some SNPs are affecting our phenotype Genotype-phenotype relationship

  33. phenotypes Correlating genetic variations and diseases • Family linkage analysis • Case-control association study Need a large pedigree!

  34. phenotypes Correlating genetic variations and diseases • Case-control association study Need a large cohort!

  35. Rare genetic diseases Common diseases

  36. Single gene Monogenic disorder Rare genetic diseases (Osteogenesis imperfecta) Rare (1:30,000 – 1:70,000) Early-onset (prenatal)

  37. An autosomal dominant disease for which the gene resides on this chromosome

  38. 1 (CA) allele CA 2 (CA) allele CACA 3 (CA) allele CACACA …… 6 (CA) allele CACACACACACA 7 (CA) allele CACACACACACACA 8 (CA) allele CACACACACACACACA

  39. Marker studied 5 6 4 7 2 3

  40. Marker studied 2 3 1 5 4 4

  41. Marker studied 1 5 3 5 6 7

  42. Marker studied 2 4 2 5 2 7

  43. Marker studied 1 3 1 2 4 5

  44. Marker studied 2 4 2 5 2 7

  45. (23) (16) (14) (26) (34) (13) (58) (12) (13) (78) (26) (47) (46) (18) (18) (46) (67) (24) Genotype other family members (24) (33) (14) (25) (27) The key is to identify a genetic marker that is always inherited by family members with the disease but not by those who do not have the disease

  46. Define the region of maximal linkage Fine mapping Gene resides here Disease gene Causative mutation!

  47. Logarithm of odds (LOD) score • The logarithm (in base 10) of the odds of linkage • the ratio of the likelihood that loci are linked to the likelihood that they are not linked • A LOD of 3.0 = odds of 1000/1 in favour of linkage • Equivalent to a 5% chance of error Degree of linkage

  48. Advantages: Localization of areas associated with increase disease risk across the genome Can study multiple markers simultaneously Disadvantages Multi-generational cases difficult to recruit with high mortality conditions Difficult to study late-onset diseases/traits Difficult to study complex traits Family linkage studies

  49. Environment Interactions between environment and genes 1 4 2 3 Complex traits (common) Diabetes Osteoporosis Osteoarthritis Alzheimer Cancer Genetics Interaction between genes (Risk factors) Many genes may be involved

  50. Linkage deals with a specific genetic relationship between loci on a chromosome Association describes a statistical relationship between genes or genetic variants and the disease/trait of interest Association study for complex traits

More Related