DNA, Transcription, Translation, Phenotype

1. DNA, Transcription, Translation, Phenotype • Example: • Oryza sativa and fragrance http://www.riceassociation.org.uk/content/1/13/the-rice-plant.html http://dish.allrecipes.com/how-to-cook-rice/

2. Oryza sativa • Perfect flower; Self-pollinated; Hybrids with CMS • Domesticated from O. rufipogon; ~ 10,000 years ago. Asia • O. glaberrimadomesticated in West Africa • Aromatic rice • Basmati – India and Pakistan • Jasmine – Thailand • Texmati – USA • http://ricepedia.org/

3. Phenotype • Inheritance of aroma in rice Genetics Doubled haploids Pinson, S. 1994. Crop Sci. 34:1151-1157. Mendelian analysis

4. Locus, gene, allele • BAD2 and aroma in rice • Summary (Abstract) • The phenotype (fragrance) and the compound 2-acetyl-1pyroline. • Recessive gene (fgr) associated (avoid using “linkage” in this context) with the phenotype. • Genes, proteins, and metabolic compounds – fgrencodes BAD (betaine aldehyde dehydrogenase). • Polymorphisms in coding region – alleles at fgr. • Loss-of-function mutations = accumulation of BAD = fragrance. • The BAD gene family – genes with similar sequence and function. In this case on different chromosomes.

5. BAD2 and aroma in rice • Summary (Abstract) • Potential pleiotropic* effects of BAD: fragrance and stress tolerance? • Selection for recessive traits during domestication** Aroma * ? ** Fitness in natural ecosystems vs. Fitness in agroecosystems

6. BAD2 and aroma in rice • Introduction • 2-acetyl-1pyroline implicated in flavor in a range of foods • 2-acetyl-1pyroline • High in basmati and jasmine rice • Low in non-fragrant rice • Fgr locus mapped to chromosome 8 (by linkage mapping*) *Establishing the order and “relative distance” of genes and/or genetic markers on chromosomes based on frequency of recombination in meiosis (degree of linkage) and distance expressed as centiMorgans (cM) More recombination events = greater distance

7. BAD2 and aroma in rice • Introduction • Genetic markers* developed to allow selection.** • Defined chromosomal locations in segregating populations • using genetic markers: • Simple Sequence Repeats (SSRs; aka microsatellites). • Single Nucleotide Polymorphisms (SNPs). • * • DNA-level polymorphisms in and around fgr locus. • Markers can be in coding regions of genes, in non-coding regions of genes, or in DNA not coding for genes. • Marker polymorphisms based on mutations. • ** • Select for aroma based on marker polymorphisms rather than by measuring/assessing aroma. • Marker Assisted Selection (MAS) vs. phenotypic selection.

8. BAD2 and aroma in rice • Introduction • Simple Sequence Repeats (SSRs). • Repeats of variable lengths flanked by consensus sequences. Excellent genetic markers. Highly polymorphic. Most prevalent in non-coding DNA. Examples of SSRs in hazelnut; Mehlenbacher lab

9. BAD2 and aroma in rice • Introduction • Single Nucleotide Polymorphisms (SNPs)… Silent *** CTG GGA GAT TAT GGC TTT AAG*** *** CTG GGA GAT TAT GGC TTC AAG*** alignment LeuGly Asp Tyr GlyPhe Lys LeuGly Asp Tyr GlyPhe Lys translation Excellent genetic markers. Most widely-used type of genetic marker (2019). In coding and non-coding DNA. High throughput. Missense *** CTG GGA GAT TAT GGC TTT AAG*** *** CTG GGA GAT TAT GGC TAT AAG*** alignment LeuGly Asp Tyr GlyPhe Lys LeuGly Asp Tyr GlyTyr Lys translation Nonsense *** CTG GGA GAT TAT GGC TTT AAG*** *** CTG GGA GAT TAG GGC TTT AAG*** alignment LeuGly Asp Tyr GlyPhe Lys LeuGly Asp STOP translation

10. BAD2 and aroma in rice • Introduction • Rice genome sequence

11. Synteny • Model plants • 95% of 389 Mb genome • Euchromatin • Two complete centromeres • 37,544 protein coding genes (not counting transposable elements) • ~70% - homologues in Arabidopsis • Clustered gene families • Transposable elements and genome expansion • Proteome • Gene exchange between nuclear and organellar genomes • SNPs and SSRs accelerate improvements in rice production

12. Synteny: Genes of similar structure and function in similar orders in different species. Homology: In different species, similarity between genes in terms of structure and function – infer common ancestry. Gene families: A set of similar genes within a species – infer duplication of a single ancestral gene. Can be clustered or dispersed. Transposable elements: DNA sequences that can move from one region of the genome to another. Found in large numbers and account for a significant % of the total genome (~90% in maize). Genome expansion: Increases in genome size due to increased copy number of transposable elements - not polyploidization. Genome, transcriptome, proteome, metabolome, phenome......

13. The story (the paper, the online narrative). The essential details (the data). Requires bioinformatics tools. AAGAGAGCAGTAAGAGCATCCCAGCAGCTCCTCTATCTAGGCATCCATCCGATATTTGGAGTATGGAGGAGAAAAACAGTGCTCCAGCAGAGTCTCCATCACATGCTTCATTTTTGGAGGTCCTCCAAATCTAGCCCTTCCCAAGCCAAAT

14. BAD2 and aroma in rice • Results and Discussion • Locating fgr: genetic maps (centiMorgans (cM)), Bacterial Artificial Chromosome (BAC) clones, and physical maps (Kb) Overlapping BAC contigs Physical map (b, Kb, Mb) Genetic map (cM)

15. Cloning Vectors • Propagate and maintain DNA fragments • Key feature of the cloning vector: size of the DNA insert • Plasmid ~ 1 kb • BAC ~ 200 kb

16. BAD2 and aroma in rice • Results and Discussion • Within BAC clone – a cDNA clone encoding betaine aldehyde dehydrogenase • cDNA = DNA complementary to RNA

17. mRNA to cDNA Reverse transcriptase

18. From gene to phenotype – revisited DNA cDNA = gDNA minus introns, processed sections RNA • Other genes • Pathways • Environmental • signals Protein

19. BAD2 and aroma in rice Results and Discussion Structure of fgr

20. BAD2 and aroma in rice Results and Discussion Structure of fgr

21. BAD2 and aroma in rice • Results and Discussion • Structure of fgr • DNA sequenceidentical in fragrant rice accessions (14) • DNA sequence identical in non-fragrant accessions (64) • Fragrant sequence different from non-fragrant sequence Determining DNA sequence

22. DNA sequencing • Advances in technology have removed the technical obstacles to determining thenucleotide sequence of agene, a chromosome region, or a whole genome.

23. DNA-revisited Purines Pyrmidines http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/N/Nucleotides.html

24. Sanger DNA Sequencing - classic but not obsolete The gold standard for accurate sequencing of short (~ 650 bp) DNA sequences

25. Next Generation Sequencing - Illumina Lots of short read data in a short time, at a good price https://www.youtube.com/watch?annotation_id=annotation_228575861&feature=iv&src_vid=womKfikWlxM&v=fCd6B5HRaZ8

26. Sequencing - PAC Bio Long reads! https://www.youtube.com/watch?v=v8p4ph2MAvI

27. Sequencing - Nanopore Potentially, cheap, fast, portable

28. BAD2 and aroma in rice • Results and Discussion • Structure of fgr • DNA sequence identical in fragrant rice accessions (14) • DNA sequence identical in non-fragrant accessions (64) • Fragrant sequence different from non-fragrant sequence Comparing DNA sequence

29. Barley Vrs1 (Hox1): Sequence from a 6-row accession Is there a similar sequence in rice?

30. Barley Vrs1 (Hox1): Sequence from a 6-row accession Is there a similar sequence in rice?

31. Barley Vrs1 (Hox1): Sequence from a 6-row accession Is there a similar sequence in rice?

32. Barley Vrs1 (Hox1): Sequence from a 6-row accession Is there a similar sequence in rice? https://community.gep.wustl.edu/wiki/images/2/28/2011_8b_BLASTrv7_rev.pdf

33. Barley Vrs1 (Hox1): Sequence from a 6-row accession Is there a similar sequence in rice?

34. BAD2 and aroma in rice • Results and Discussion • Amino acid sequence alignment

35. BAD2 and aroma in rice • Results and Discussion • Amino acid (or nucleic acid) sequence alignment

36. DNA to RNA to protein

37. DNA to protein DNA, transcription, translation

38. DNA, Transcription, Translation, Phenotype • Example: • Oryza sativa and fragrance http://www.riceassociation.org.uk/content/1/13/the-rice-plant.html http://dish.allrecipes.com/how-to-cook-rice/